wp.pl
wp.pl
Najpopularniejszy w Polsce portal o finansach i biznesie
Money.plTechnologie dla biznesuPrzemysłPatentyEP 1781772 T3
Wyszukiwarka patentów
  • od
  • do
Patent EP 1781772 T3


EP 1781772 T3

RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (96) Data i numer zgłoszenia patentu europejskiego: 15.07.2005 05763114.5 (11) PL/EP (13) (51) 1781772 T3 Int.Cl. C12N 1/14 (2006.01) C12N 1/18 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (54) (97) O udzieleniu patentu europejskiego ogłoszono: 28.09.2016 Europejski Biuletyn Patentowy 2016/39 EP 1781772 B1 C12P 7/00 (2006.01) C12P 7/08 (2006.01) C12N 9/92 (2006.01) Tytuł wynalazku: Metaboliczne modyfikowanie fermentujących ksylozę komórek eukariotycznych (30) (43) Pierwszeństwo: 16.07.2004 EP 04077073 16.07.2004 US 588381 P 22.07.2004 US 589833 P Zgłoszenie ogłoszono: 09.05.2007 w Europejskim Biuletynie Patentowym nr 2007/19 (45) O złożeniu tłumaczenia patentu ogłoszono: 31.03.2017 Wiadomości Urzędu Patentowego 2017/03 (73) Uprawniony z patentu: DSM IP Assets B.V., Heerlen, NL PL/EP 1781772 T3 (72) Twórca(y) wynalazku: AARON ADRIAAN WINKLER, Den Haag, NL SIPKO MAARTEN KUYPER, Delft, NL WILHELMUS THEODORUS ANTONIUS MARIA DE LAAT, Breda, NL JOHANNES PIETER VAN DIJKEN, Leidschendam, NL JACOBUS THOMAS PRONK, Schipluiden, NL (74) Pełnomocnik: rzecz. pat. Piotr Godlewski JWP RZECZNICY PATENTOWI DOROTA RZĄŻEWSKA SP. J. ul. Żelazna 28/30 Sienna Center 00-833 Warszawa Uwaga: W ciągu dziewięciu miesięcy od publikacji informacji o udzieleniu patentu europejskiego, każda osoba może wnieść do Europejskiego Urzędu Patentowego sprzeciw dotyczący udzielonego patentu europejskiego. Sprzeciw wnosi się w formie uzasadnionego na piśmie oświadczenia. Uważa się go za wniesiony dopiero z chwilą wniesienia opłaty za sprzeciw (Art. 99 (1) Konwencji o udzielaniu patentów europejskich). 28191/16/ZWA/PG EP 1 781 772 Metaboliczne modyfikowanie fermentujących ksylozę komórek eukariotycznych Opis Dziedzina wynalazku [0001] Wynalazek dotyczy dalszych modyfikacji genetycznych w eukariotycznych komórkach gospodarza, które transformowano, by eksprymowały izomerazę ksylozowa, która nadaje komórce gospodarza zdolność izomeryzacji ksylozy do ksylulozy. Dalsze modyfikacje genetyczne są nakierowane na poprawianie skuteczności metabolizmu ksylozy i obejmują np. zmniejszanie nieswoistej aktywności reduktazy aldozowej, zwiększoną aktywność kinazy ksylulozowej i zwiększony strumień szlaku pentozofosforanowego. Modyfikowane komórki gospodarza według wynalazku są odpowiednie do wytwarzania szerokiej gamy produktów fermentacji w procesach zawierających ksylozę jako źródło węgla. Tło wynalazku [0002] Ekonomicznie opłacalne wytwarzanie etanolu z frakcji hemicelulozy biomasy roślinnej wymaga równoczesnej konwersji zarówno pentoz, jak i heksoz z porównywalnymi szybkościami i wysokimi wydajnościami. Drożdże, zwłaszcza Saccharomyces spp., są najbardziej odpowiednimi kandydatami do tego procesu, ponieważ mogą one szybko rosnąć na heksozach, zarówno tlenowo, jak i beztlenowo. Poza tym są one znacznie bardziej odporne na toksyczne środowisko hydrolizatów lignocelulozy niż (genetycznie modyfikowane) bakterie. [0003] We wcześniejszych badaniach przedstawiono dowody, że metaboliczne modyfikowanie S. cerevisiae pod kątem wykorzystywania ksylozy powinno opierać się na wprowadzeniu izomerazy ksylozowej (XI, EC 5.3.1.5) Bruinenberg i wsp. (1983, Eur J. Appl. Microbiol. Biotechnol. 18: 287-292). W przeciwieństwie do szczepów, które są oparte na reduktazie ksylozowej (XR, EC 1.1.1.21) i dehydrogenazie ksylitolowej (XD, EC 1.1.1.9), szczepy eksprymujące aktywność XI prezentują wysokie wydajności alkoholu i niemal nie wytwarzają ksylitolu, jak zademonstrowano niedawno w WO 03/0624430 i Kuyper i wsp. (2004, FEMS Yeast Res. 4: 655-664). Z teoretycznego punktu widzenia nie jest to zaskakujące, gdyż szlak za pośrednictwem XR i XD prowadzi do zakłócenia równowagi NADH, który pod nieobecność tlenu, można zmniejszyć np. poprzez utworzenie ksylitolu. [0004] W WO 03/0624430 ujawnia się, że wprowadzenie funkcjonalnego Piromyces XI do S. cerevisiae umożliwia uzyskanie powolnego metabolizmu ksylozy za pośrednictwem endogennej ksylulokinazy (EC 2.7.1.17) kodowanej przez XKS1 i enzymów nieoksydacyjnej części szlaku pentozofosforanowego, i nadaje transformantom drożdży zdolność do wzrostu na ksylozie. [0005] Kuyper i wsp. (supra) ujawniają szczepy S. cerevisiae, do których wprowadzono Piromyces XI i które poddawano następnie ukierunkowanej ewolucji w wytrząsanych kolbach, uzyskując ulepszone szybkości fermentacji ksylozy, przy ciągłym zapotrzebowaniu na tlen do wzrostu. Dalsza selekcja za pośrednictwem schematu skrajnego ograniczenia tlenu w warunkach nadmiaru ksylozy, z późniejszą beztlenową selekcją skutkuje uzyskaniem -2laboratoryjnego szczepu (RWB202-AFX), który spełnia co najmniej jedno z wstępnych wymagań w zakresie wykorzystywania hemicelulozy, a mianowicie dopuszczalną wydajność etanolu na ksylozie. Jednak swoista szybkość wytwarzania etanolu w tym szczepie nadal jest niedopuszczalnie niska. Zwłaszcza, swoista szybkość zużywania cukru podczas wzrostu na ksylozie (345 mg ksylozy/g biomasy/godz.) jest nadal dziesięciokrotnie niższa niż na glukozie. Próby dalszego ulepszania szczepu RWB202-AFX za pośrednictwem ewolucyjnego modyfikowania jak dotąd nie zakończyły się sukcesem. [0006] W WO 03/0624430 wyszczególnia się szereg alternatywnych modyfikacji genetycznych, które mogą skutkować dalszą poprawą swoistych szybkości wytwarzania etanolu i/lub zużycia cukru na ksylozie w komórkach gospodarza eksprymujących gen Piromyces XI na poziomie, który byłby wymagany do komercyjnego wykorzystywania hemicelulozy. Te alternatywy obejmują: (a) zwiększenie transportu ksylozy do komórki gospodarza; (b) zwiększoną aktywność kinazy ksylulozowej; (c) zwiększony strumień szlaku pentozofosforanowego; (d) zmniejszoną wrażliwość na represję kataboliczną; (e) zwiększoną tolerancję na etanol, osmolarność lub kwasy organiczne; i (f) zmniejszone wytwarzanie produktów ubocznych (takich jak np. ksylitol, glicerol i/lub kwas octowy). Dokładniej, w WO 03/0624430 sugeruje się nadeksprymowanie jednego lub większej liczby genów kodujących transporter heksoz lub pentoz, enzymu kinazy ksylulozowej (takiego jak S. cerevisiae XKS1) ze szlaku pentozofosforanowego, takich jak enzymy glikolityczne transaldolaza (TAL1) lub transketolaza (TKL1), enzymów etanologenicznych takich jak dehydrogenazy alkoholowe, i/lub inaktywowanie genu kinazy heksozowej, np. genu S. cerevisiae HXK2, genów S. cerevisiae MIG1 lub MIG2, genów (nieswoistej) reduktazy aldozowej, takich jak gen S. cerevisiae GRE3, lub genów dla enzymów zaangażowanych w metabolizm glicerolu, takich jak geny S. cerevisiae dehydrogenazy glicerolo-fosforanowej 1 i/lub 2. W WO 03/0624430 nie ujawnia się jednak, które z tych wielu alternatyw faktycznie dają poprawę swoistych szybkości wytwarzania etanolu i/lub zużywania ksylozy w komórkach gospodarza niosących gen Piromyces XI. [0007] Karhumaa i wsp. (2004, ?Development of a Xylose-growing Saccharomyces cerevisiae strain expressing bacterial xylose isomerase?, prezentacja posteru na drugim spotkaniu poświęconym fizjologii drożdży i grzybów nitkowatych (second meeting on Physiology of Yeasts and Filamentous Fungi); 24-28 marca 2004 r., Anglet, Francja. strona 43; i, 2004, ?New Xylose-growing Saccharomyces cerevisiae strain for biofuel ethanol production?, prezentacja ustna na 26. sympozjum poświęconym biotechnologii w kontekście paliw i chemikaliów (26th Symposium on Biotechnology for fuels and chemicals), 9-12 maja, 2004 r., Chattanooga (TN), USA. strona 19) ujawnia szczep S. cerevisiae eksprymujący bakteryjny XI z Thermus thermophilus. Szczep zawiera ponadto szereg modyfikacji genetycznych zasugerowanych w WO 03/0624430: nadekspresja kinazy ksylulozowej i wszystkich czterech enzymów nieoksydacyjnego szlaku pentozofosforanowego, jak również inaktywacja genu S. cerevisiae nieswoistej reduktazy aldozowej (GRE3). Jednak pomimo tych modyfikacji genetycznych szczep ten jest niezdolny do wzrostu na ksylozie. Dopiero po przystosowaniu do tlenowego wzrostu na ksylozie uzyskano szczep, TMB3050, który jest zdolny do wzrostu na ksylozie z niską szybkością (? = 0,04 godz.-1) i z niską swoistą -3szybkością zużywania ksylozy rzędu 4,3 mg ksylozy/g komórek/godz. Jako że po pierwsze niezdefiniowane modyfikacje genetyczne (ulegające akumulacji podczas przystosowania) były wyraźnie wymagane do wzrostu na ksylozie, nie można wydedukować z pracy Karhumaa i wsp., które, o ile którekolwiek, ze zdefiniowanych modyfikacji genetycznych (takich jak nadekspresja kinazy ksylulozowej lub dowolnych z enzymów szlaku pentozofosforanowego lub inaktywacja genu reduktazy aldozowej) faktycznie przyczyniają się do zdolności przystosowanego szczepu do wzrostu na ksylozie. [0008] Tym samym, celem wynalazku jest zapewnienie eukariotycznych komórek gospodarza, takich jak grzybowe komórki gospodarza, które są transformowane genem XI, który nadaje zdolność do wzrostu na ksylozie i które to komórki gospodarza mają swoiste szybkości zużywania ksylozy i/lub tworzenia produktu (etanolu), które są kompatybilne z komercyjnym stosowaniem komórek gospodarza. Opis wynalazku Definicje Izomeraza ksylozowa [0009] Enzym ?izomeraza ksylozowa? (EC 5.3.1.5) zdefiniowano w opisie jako enzym, który katalizuje bezpośrednią izomeryzację D-ksylozy do D-ksylulozy i vice versa. Enzym jest również znany jako ketoizomeraza D-ksylozowa. Pewne izomerazy ksylozowe są również zdolne do katalizowania konwersji pomiędzy D-glukozą i D-fruktozą i są tym samym określane niekiedy jako izomeraza glukozowa. Izomerazy ksylozowe wymagają dwuwartościowych kationów jak magnez lub mangan w charakterze kofaktora. Izomerazy ksylozowe według wynalazku mogą być dalej definiowane za pomocą ich sekwencji aminokwasowej jak przedstawiono w opisie poniżej. Podobnie, izomerazy ksylozowe można definiować za pomocą sekwencji nukleotydowych kodujących enzym, jak również za pomocą sekwencji nukleotydowych hybrydyzujących do referencyjnej sekwencji nukleotydowej kodującej izomerazę ksylozową jak przedstawiono w opisie poniżej. [0010] Jednostkę (U) aktywności izomerazy ksylozowej zdefiniowano w opisie jako ilość enzymu wytwarzającą 1 nmol ksylulozy na minutę, w warunkach jak opisano w Kuyper i wsp. (2003, FEMS Yeast Res. 4: 69-78). Kinaza ksylulozowa [0011] Enzym ?kinazę ksylulozową? (EC 2.7.1.17) zdefiniowano w opisie jako enzym który katalizuje reakcję ATP + D-ksyluloza = ADP + D-ksylulozo-5-fosforan. Enzym jest również znany jako fosforylująca ksylulokinaza, D-ksylulokinaza lub ATP:D-ksylulozo-5fosfotransferaza. Kinaza ksylulozowa według wynalazku może być dalej definiowana za pomocą jej sekwencji aminokwasowej, jak przedstawiono w opisie poniżej. Podobnie kinaza ksylulozowa może być definiowana za pomocą sekwencji nukleotydowych kodujących enzym, jak również za pomocą sekwencji nukleotydowych hybrydyzujących do referencyjnej sekwencji nukleotydowej kodującej kinazę ksylulozową jak przedstawiono w opisie poniżej. Jednostkę aktywności ksylulokinazy zdefiniowano w Przykładzie 1.13 opisu. -4- Epimeraza rybulozo-5-fosforanowa [0012] Enzym ?epimerazę rybulozo-5-fosforanową? (5.1.3.1) zdefiniowano w opisie jako enzym, który katalizuje epimeryzację D-ksylulozo-5-fosforanu do D-rybulozo-5-fosforanu i vice versa. Enzym jest również znany jako epimeraza fosforybulozowa; izomeraza erytrozo4-fosforanowa; 3-epimeraza fosfoketopentozowa; 3-epimeraza ksylulozo-fosforanowa; epimeraza fosfoketopentozowa; 3-epimeraza rybulozo-5-fosforanowa; 3-epimeraza Drybulozo-fosforanowa; epimeraza D-rybulozo-5-fosforanowa; 3-epimeraza D-rybulozo-5-P; 3-epimeraza D-ksylulozo-5-fosforanowa; 3-epimeraza pentozo-5-fosforanowa; lub 3epimeraza D-rybulozo-5-fosforanowa. Epimeraza rybulozo-5-fosforanowa według wynalazku może być dalej definiowana za pomocą jej sekwencji aminokwasowej jak przedstawiono w opisie poniżej. Podobnie epimeraza rybulozo-5-fosforanowa może być definiowana za pomocą sekwencji nukleotydowych kodujących enzym, jak również za pomocą sekwencji nukleotydowych hybrydyzujących do referencyjnej sekwencji nukleotydowej kodującej epimerazę rybulozo-5-fosforanową jak przedstawiono w opisie poniżej. Izomeraza rybulozo-5-fosforanowa [0013] Enzym ?izomerazę rybulozo-5-fosforanową? (EC 5.3.1.6) zdefiniowano w opisie jako enzym, który katalizuje bezpośrednią izomeryzację D-rybozo-5-fosforanu do D-rybulozo-5fosforanu i vice versa. Enzym jest również znany jako izomeraza fosfopentozowa; fosforyboizomeraza; izomeraza rybozo-fosforanowa; izomeraza 5-fosforybozowa; izomeraza D-rybozo-5-fosforanowa; ketolo-izomeraza D-rybozo-5-fosforanowa; lub aldozo-ketozoizomeraza D-rybozo-5-fosforanowa. Izomeraza rybulozo-5-fosforanowa według wynalazku może być dalej definiowana za pomocą jej sekwencji aminokwasowej jak przedstawiono w opisie poniżej. Podobnie izomeraza rybulozo-5-fosforanowa może być definiowana za pomocą sekwencji nukleotydowych kodujących enzym jak również za pomocą sekwencji nukleotydowych hybrydyzujących do referencyjnej sekwencji nukleotydowej kodującej izomerazę rybulozo-5-fosforanową jak przedstawiono w opisie poniżej. Transketolaza [0014] Enzym ?transketolazę? (EC 2.2.1.1) zdefiniowano w opisie jako enzym, który katalizuje reakcję: D-rybozo-5-fosforan + D-ksylulozo-5-fosforan ? sedoheptulozo-7-fosforan + 3-fosforano-Dgliceraldehyd i vice versa. Enzym jest również znany jako glikoloaldehydotransferaza lub glikolaldehydotransferaza sedoheptulozo-7-fosforanowa:D-gliceraldehydo-3-fosforanowa. Transketolaza według wynalazku może być dalej definiowana za pomocą jej sekwencji aminokwasowej jak przedstawiono w opisie poniżej. Podobnie transketolaza może być definiowana za pomocą sekwencji nukleotydowych kodujących enzym jak również za pomocą sekwencji nukleotydowych hybrydyzujących do referencyjnej sekwencji nukleotydowej kodującej transketolazę jak przedstawiono w opisie poniżej. Transaldolaza -5[0015] Enzym ?transaldolazę? (EC 2.2.1.2) zdefiniowano w opisie jako enzym, który katalizuje reakcję: sedoheptulozo-7-fosforan + D-gliceraldehydo-3-fosforan ? D-erytrozo-4fosforan + D-fruktozo-6-fosforan i vice versa. Enzym jest również znany jako transferaza dihydroksyacetonowa; syntaza dihydroksyacetonowa; transketolaza formaldehydowa; lub gliceronotransferaza sedoheptulozo-7-fosforanowa:D-gliceraldehydo-3-fosforanowa. Transaldolaza według wynalazku może być dalej definiowana za pomocą jej sekwencji aminokwasowej jak przedstawiono w opisie poniżej. Podobnie transaldolaza może być definiowana za pomocą sekwencji nukleotydowych kodujących enzym jak również za pomocą sekwencji nukleotydowych hybrydyzujących do referencyjnej sekwencji nukleotydowej kodującej transaldolazę jak przedstawiono w opisie poniżej. Reduktaza aldozowa [0016] Enzym ?reduktazę aldozową? (EC 1.1.1.21) zdefiniowano w opisie jako dowolny enzym, który jest zdolny do redukowania ksylozy lub ksylulozy do ksylitolu. W kontekście wynalazku reduktaza aldozowa może oznaczać dowolną nieswoistą reduktazę aldozową, która jest natywna (endogenna) dla komórki gospodarza według wynalazku i która jest zdolna do redukowania ksylozy lub ksylulozy do ksylitolu. Nieswoiste reduktazy aldozowe katalizują reakcję: aldoza + NAD(P)H + H+ ? alditol + NAD(P)+ [0017] Enzym ma szeroką swoistość i jest również znany jako reduktaza aldozowa; dehydrogenaza poliolu (NADP+); oksydoreduktaza alditolowa:NADP; 1-oksydoreduktaza alditolowa:NADP+; reduktaza NADPH-aldopentozowa; lub reduktaza NADPH-aldozowa. Szczególnym przykładem takiej nieswoistej reduktazy aldozowej jest ta, która jest endogenna dla S. cerevisiae i która jest kodowana przez gen GRE3 (Traff i wsp., 2001, Appl. Environ. Microbiol. 67: 5668-74). Stąd reduktaza aldozowa według wynalazku może być dalej definiowana za pomocą jej sekwencji aminokwasowej jak przedstawiono w opisie poniżej. Podobnie reduktaza aldozowa może być definiowana za pomocą sekwencji nukleotydowych kodujących enzym jak również za pomocą sekwencji nukleotydowych hybrydyzujących do referencyjnej sekwencji nukleotydowej kodującej reduktazę aldozową jak przedstawiono w opisie poniżej. Identyczność sekwencji i podobieństwo [0018] Identyczność sekwencji zdefiniowano w opisie jako związek pomiędzy dwoma lub więcej sekwencjami aminokwasowymi (polipeptyd lub białko) lub dwoma lub więcej sekwencjami kwasu nukleinowego (polinukleotyd), jak określono przez porównanie sekwencji. W stanie techniki ?identyczność? oznacza również stopień pokrewieństwa sekwencji pomiędzy sekwencjami aminokwasowymi lub sekwencjami kwasu nukleinowego, w zależności od przypadku, jak określono przez dopasowanie pomiędzy ciągami takich sekwencji. ?Podobieństwo? pomiędzy dwoma sekwencjami aminokwasowymi określa się -6porównując sekwencje aminokwasowe i ich podstawienia konserwatywnych aminokwasów z jednego polipeptydu do sekwencji drugiego polipeptydu. ?Identyczność? i ?podobieństwo? można łatwo obliczyć znanymi sposobami, w tym nieograniczająco tymi opisanymi w (Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., i Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heine, G., Academic Press, 1987; i Sequence Analysis Primer, Gribskov, M. i Devereux, J., eds., M Stockton Press, New York, 1991; i Carillo, H., i Lipman, D., SIAM J. Applied Math., 48:1073 (1988). [0019] Zaprojektowano korzystne sposoby do określania identyczności, by dawały największe dopasowanie pomiędzy testowanymi sekwencjami. Sposoby do określenia identyczności i podobieństwa są skodyfikowane w publicznie dostępnych programach komputerowych. Korzystne sposoby dotyczące programów komputerowych, dla określenia identyczności i podobieństwa pomiędzy dwoma sekwencjami obejmują np. pakiet programów GCG (Devereux, J., i wsp., Nucleic Acids Research 12 (1):387 (1984)), BestFit, BLASTP, BLASTN, i FASTA (Altschul, S. F. i wsp., J. Mol. Biol. 215:403-410 (1990). Program BLAST X jest publicznie dostępny z NCBI i innych źródeł (BLAST Manual, Altschul, S., i wsp., NCBI NLM NIH Bethesda, MD 20894; Altschul, S., i wsp., J. Mol. Biol. 215:403-410 (1990). Można również stosować dobrze znany algorytm Smitha-Watermana do określenia identyczności. [0020] Korzystne parametry do porównywania sekwencji polipeptydu obejmują poniższe: Algorytm: Needleman i Wunsch, J. Mol. Biol. 48:443-453 (1970); macierz do porównywania: BLOSSUM62 według Hentikoff i Hentikoff, Proc. Natl. Acad. Sci. USA. 89:10915-10919 (1992); kara za przerwę: 12; i kara za wydłużenie przerwy: 4. Użyteczny program z tymi parametrami jest publicznie dostępny jako program ?Ogap? od Genetics Computer Group, z lokalizacją w Madison, WI. Wymienione powyżej parametry to parametry domyślne do porównań aminokwasów (wraz z brakiem kary za przerwę na końcu). [0021] Korzystne parametry do porównywania kwasu nukleinowego obejmują poniższe: Algorytm: Needleman i Wunsch, J. Mol. Biol. 48:443-453 (1970); macierz do porównywania: dopasowania=+10, niedopasowanie=0; kara za przerwę: 50; kara za wydłużenie przerwy: 3. Dostępny jako program Gap od Genetics Computer Group, z lokalizacją w Madison, Wis. Podane powyżej to parametry domyślne do porównań kwasów nukleinowych. [0022] Opcjonalnie, przy wyznaczaniu stopnia podobieństwa aminokwasów znawca dziedziny może również uwzględnić tzw. ?konserwatywne? substytucje aminokwasów, co będzie jasnym dla znawcy dziedziny. Konserwatywne substytucje aminokwasów dotyczą wymienialności reszt mających podobne łańcuchy boczne. Na przykład, grupa aminokwasów mających alifatyczne łańcuchy boczne to glicyna, alanina, walina, leucyna i izoleucyna; grupa aminokwasów mających alifatyczne-hydroksylowe łańcuchy boczne to seryna i treonina; grupa aminokwasów mających łańcuchy boczne zawierające amidy to asparagina i glutamina; grupa aminokwasów mających aromatyczne łańcuchy boczne to fenyloalanina, tyrozyna -7i tryptofan; grupa aminokwasów mających zasadowe łańcuchy boczne to lizyna, arginina i histydyna; i grupa aminokwasów mających łańcuchy boczne zawierające siarkę to cysteina i metionina. Korzystne konserwatywne grupy aminokwasów do substytucji to: walinaleucyna-izoleucyna, fenyloalanina-tyrozyna, lizyna-arginina, alanina-walina i asparaginaglutamina. Warianty substytucyjne sekwencji aminokwasowych ujawnionych w opisie oznaczają te, w których usunięto co najmniej jedną resztę w ujawnionej sekwencji, i wprowadzono w to miejsce inną resztę. Korzystnie, zmiana aminokwasu jest konserwatywna. Korzystne konserwatywne substytucje dla każdego z naturalnie występujących aminokwasów są jak następuje: Ala do ser; Arg do lys; Asn do gln lub his; Asp do glu; Cys do ser lub ala; Gln do asn; Glu do asp; Gly do pro; His do asn lub gln; Ile do leu lub val; Leu do ile lub val; Lys do arg; gln lub glu; Met do leu lub ile; Phe do met, leu lub tyr; Ser do thr; Thr do ser; Trp do tyr; Tyr to trp lub phe; i Val do ile lub leu. Hybrydyzowanie sekwencji kwasu nukleinowego [0023] Sekwencje nukleotydowe kodujące enzymy według wynalazku można również definiować przez ich zdolność do hybrydyzacji z sekwencjami nukleotydowymi odpowiednio z SEQ ID NO. 9-16 i 18, w umiarkowanych, lub korzystnie w rygorystycznych warunkach hybrydyzacji. Rygorystyczne warunki hybrydyzacji są definiowane w opisie jako warunki, które pozwalają na hybrydyzację sekwencji kwasu nukleinowego mającej co najmniej około 25, korzystnie około 50 nukleotydów, 75 lub 100 i najbardziej korzystnie około 200 lub więcej nukleotydów, w temperaturze około 65°C w roztworze zawierającym około 1 M sól, korzystnie 6 x SSC lub jakimkolwiek innym roztworze mającym porównywalną siłę jonową, i odmywanie w temp. 65°C w roztworze zawierającym około 0,1 M sól, lub mniej, korzystnie 0,2 x SSC lub jakimkolwiek innym roztworze mającym porównywalną siłę jonową. Korzystnie, hybrydyzację prowadzi się przez noc, tj. co najmniej przez 10 godzin i korzystnie odmywanie prowadzi się przez co najmniej jedną godzinę, z co najmniej dwoma zmianami roztworu do odmywania. Te warunki zazwyczaj umożliwią swoistą hybrydyzację sekwencji mających około 90% lub więcej identyczności sekwencji. [0024] Umiarkowane warunki są definiowane w opisie jako warunki, które pozwalają na hybrydyzację sekwencji kwasu nukleinowego mającej co najmniej 50 nukleotydów, korzystnie około 200 lub więcej nukleotydów, w temperaturze około 45°C w roztworze zawierającym około 1 M sól, korzystnie 6 x SSC lub jakimkolwiek innym roztworze mającym porównywalną siłę jonową, i odmywanie w temp. pokojowej, w roztworze zawierającym około 1 M sól, korzystnie 6 x SSC lub jakimkolwiek innym roztworze mającym porównywalną siłę jonową. Korzystnie, hybrydyzację prowadzi się przez noc, tj. co najmniej przez 10 godzin i korzystnie odmywanie prowadzi się przez co najmniej jedną godzinę, z co najmniej dwoma zmianami roztworu do odmywania. Te warunki zazwyczaj umożliwią swoistą hybrydyzację sekwencji mających aż do 50% identyczności sekwencji. Znawca dziedziny będzie zdolny do modyfikowania tych warunków hybrydyzacji dla swoistego identyfikowania sekwencji różniących się identycznością w zakresie pomiędzy 50% i 90%. Funkcjonalnie połączony -8[0025] Według opisu pojęcie ?funkcjonalnie połączony? dotyczy wiązania elementów polinukleotydowych w funkcjonalne związki. Kwas nukleinowy jest ?połączony funkcjonalnie?, kiedy jest w funkcjonalnym związku z inną sekwencją kwasu nukleinowego. Przykładowo, promotor lub enhancer jest połączony funkcjonalnie z sekwencją kodującą, jeżeli oddziałuje na transkrypcję sekwencji kodującej. Połączenie funkcjonalnie oznacza, że łączone sekwencje DNA typowo sąsiadują ze sobą i, tam, gdzie jest to konieczne do połączenia regionów kodujących dwa białka, sąsiadują i są w tej samej ramce odczytu. Promotor [0026] Według opisu pojęcie ?promotor? dotyczy fragmentu kwasu nukleinowego, którego działanie polega na kontrolowaniu transkrypcji jednego lub więcej genów, zlokalizowanego powyżej, w odniesieniu do kierunku transkrypcji miejsca inicjacji transkrypcji genu, i jest strukturalnie identyfikowany przez obecność miejsc wiązania zależnej od DNA polimerazy RNA, miejsc inicjacji transkrypcji i wszelkich innych sekwencji DNA, w tym, nieograniczająco, miejsc wiązania czynników transkrypcyjnych, miejsc wiązania białek represorów i aktywatorów i wszelkich innych sekwencji nukleotydów, znanych znawcy dziedziny, działających bezpośrednio lub pośrednio dla regulowania ilości transkrypcji z promotora. ?Konstytutywny? promotor oznacza promotor, który jest aktywny w większości warunków fizjologicznych i rozwojowych. ?Indukowalny? promotor oznacza promotor, który jest aktywny w regulacji warunków środowiskowych i rozwojowych. Homologiczny [0027] Pojęcie ?homologiczny?, gdy jest stosowane do wskazania na związek pomiędzy danym (rekombinowanym) kwasem nukleinowym lub cząsteczką polipeptydu i danym organizmem gospodarza lub komórką gospodarza, jest rozumiane jako oznaczające, że w naturze kwas nukleinowy lub cząsteczka polipeptydu są produkowane przez komórkę gospodarza lub organizmy z tego samego gatunku, korzystnie z tej samej odmiany lub szczepu. Jeśli jest homologiczna do komórki gospodarza, sekwencja kwasu nukleinowego kodująca polipeptyd będzie typowo funkcjonalnie połączona z inną sekwencją promotora lub, w stosownym przypadku, inną wydzielniczą sekwencją sygnałową i/lub sekwencją terminatora niż w jej naturalnym środowisku. Gdy jest stosowane do wskazania na związek dwóch sekwencji kwasu nukleinowego pojęcie ?homologiczny? oznacza, że jedna jednoniciowa sekwencja kwasu nukleinowego może hybrydyzować do komplementarnej jednoniciowej sekwencji kwasu nukleinowego. Stopień hybrydyzacji może zależeć od szeregu czynników, w tym poziomu identyczności pomiędzy sekwencjami i warunków hybrydyzacji, takich jak temperatura i stężenie soli, jak omówiono w dalszej części. Korzystnie region identyczności jest większy niż około 5 pz, korzystniej region identyczności jest większy niż około 10 pz. Heterologiczny [0028] Pojęcie ?heterologiczny? gdy jest stosowane w odniesieniu do kwasu nukleinowego (DNA lub RNA) lub białka dotyczy kwasu nukleinowego lub białka, które nie występują naturalnie jako część organizmu, komórki, genomu lub sekwencji DNA lub RNA, w której są -9obecne, lub które są znajdywane w komórce lub lokalizacji czy lokalizacjach w genomie lub sekwencji DNA lub RNA, które różnią się od tych, w których są znajdowane w naturze. Heterologiczne kwasy nukleinowe lub białka nie są endogenne względem komórki, do której je wprowadzono, ale zostały uzyskane z innej komórki lub wyprodukowane na drodze syntezy lub rekombinacji. Na ogół, chociaż nie jest to konieczne, takie kwasy nukleinowe kodują białka, które nie są zwykle wytwarzane przez komórkę, w której DNA ulega transkrypcji lub ekspresji. Podobnie, egzogenny RNA koduje białka, które nie są zwykle eksprymowane w komórce, w której obecny jest egzogenny RNA. Heterologiczne kwasy nukleinowe i białka można również określać jako obce kwasy nukleinowe lub białka. Dowolny kwas nukleinowy lub białko, które znawca dziedziny rozpoznałby jako heterologiczne lub obce dla komórki, w której ulegają ekspresji, są ujęte w opisie w zakresie pojęcia heterologicznego kwasu nukleinowego lub białka. Pojęcie heterologiczny dotyczy również różnych od naturalnych kombinacji sekwencji kwasu nukleinowego lub sekwencji aminokwasowych, tj. kombinacji, w których co najmniej dwie z połączonych sekwencji są obce w odniesieniu do siebie nawzajem. [0029] W opisie i jego zastrzeżeniach czasownik ?zawierać? i jego odmieniane formy stosuje się w znaczeniu nieograniczającym, dla zaznaczenia, że elementy wymienione po tym słowie są ujęte, ale elementy, których swoiście nie wymieniono nie są wykluczone. Dodatkowo, odniesienia do elementu za pomocą przedimka nieokreślonego [w języku angielskim] ?a? lub ?an? nie wykluczają możliwości, że obecny jest więcej niż jeden element, o ile kontekst nie wymaga wyraźnie, by był to jeden i wyłącznie jeden z elementów. Przedimek nieokreślony ?a? lub ?an? zatem zazwyczaj oznacza ?co najmniej jeden?. Szczegółowy opis wynalazku [0030] Wynalazek dotyczy komórki gospodarza drożdży lub grzyba nitkowatego, transformowanej konstruktem kwasu nukleinowego zawierającym sekwencję nukleotydową kodującą izomerazę ksylozową, która to izomeraza ksylozowa obejmuje sekwencję aminokwasową, która ma co najmniej 95% identyczności sekwencji względem sekwencji aminokwasowej z SEQ ID NO: 2, przy czym konstrukt kwasu nukleinowego, po transformacji komórki gospodarza, nadaje komórce gospodarza zdolność bezpośredniej izomeryzacji ksylozy do ksylulozy, przy czym komórka gospodarza obejmuje modyfikację genetyczną, która zwiększa strumień szlaku pentozofosforanowego, i przy czym modyfikacja genetyczna obejmuje nadekspresję co najmniej jednego genu z nieoksydacyjnej części szlaku pentozofosforanowego, w porównaniu z komórką gospodarza, która jest genetycznie identyczna za wyjątkiem modyfikacji genetycznej. Zdolność transformowanej komórki gospodarza do izomeryzacji ksylozy do ksylulozy oznacza bezpośrednią izomeryzację ksylozy do ksylulozy. Jest to rozumiane tak, że izomeryzacja ksylozy do ksylulozy zachodzi w pojedynczej reakcji katalizowanej przez izomerazę ksylozową, w przeciwieństwie do dwuetapowej konwersji ksylozy do ksylulozy przez ksylitolowy związek pośredni, katalizowanej odpowiednio przez reduktazę ksylozową i dehydrogenazę ksylitolową. [0031] Stąd ekspresja sekwencji nukleotydowej w komórce gospodarza wytwarza izomerazę ksylozową o swoistej aktywności rzędu co najmniej 10 U aktywności izomerazy ksylozowej - 10 na mg białka w temp. 30°C, korzystnie co najmniej 20, 25, 30, 50, 100, 200, 300 lub 500 U na mg w temp. 30°C. Swoistą aktywność izomerazy ksylozowej eksprymowaną w transformowanej komórce gospodarza zdefiniowano w opisie jako ilość jednostek aktywności izomerazy ksylozowej na mg białka wolnego od komórek lizatu komórek gospodarza, np. lizatu wolnego od komórek drożdży. Określenie aktywności izomerazy ksylozowej, ilości białka i otrzymywanie wolnego od komórek lizatu oznaczają jak opisano w Przykładzie 1.13. Stosownie do tego ekspresja sekwencji nukleotydowej kodującej izomerazę ksylozową w komórce gospodarza wytwarza izomerazę ksylozową o swoistej aktywności rzędu co najmniej 50 U aktywności izomerazy ksylozowej na mg białka w temp. 30°C, korzystnie co najmniej 100, 200, 500, 750 lub 1000 U na mg w temp. 30°C. [0032] Korzystnie, ekspresja sekwencji nukleotydowej kodującej izomerazę ksylozową w komórce gospodarza daje izomerazę ksylozową o Km dla ksylozy, które wynosi mniej niż 50, 40, 30 lub 25 mM, korzystniej, Km dla ksylozy wynosi około 20 mM lub mniej. Korzystną sekwencję nukleotydową kodującą izomerazę ksylozową można wybrać z grupy składającej się z: (a) sekwencji nukleotydowych zawierających sekwencję nukleotydową, która ma co najmniej 80, 90, 95, 97, 98, lub 99% identyczności sekwencji z sekwencją nukleotydową z SEQ ID NO.10; [0033] Sekwencja nukleotydowa kodująca izomerazę ksylozową może kodować prokariotyczną lub eukariotyczną izomerazę ksylozową, tj. izomerazę ksylozową o sekwencji aminokwasowej, która jest identyczna względem tej dla izomerazy ksylozowej, która naturalnie występuje w organizmie prokariotycznym lub eukariotycznym. Zgłaszający stwierdzili, że zdolność określonej izomerazy ksylozowej do nadawania eukariotycznej komórce gospodarza zdolności do izomeryzowania ksylozy do ksylulozy nie zależy w dużym stopniu od tego, czy izomeraza jest pochodzenia prokariotycznego lub eukariotycznego. Zależy to raczej od pokrewieństwa sekwencji aminokwasowej izomerazy dla sekwencji z Piromyces (SEQ ID NO.1). Co zaskakujące, eukariotyczna izomeraza Piromyces jest bliżej spokrewniona z prokariotycznymi izomerazami, niż z innymi znanymi eukariotycznymi izomerazami. Izomeraza z Piromyces prezentuje 61% identyczność aminokwasów z enzymem z Xanthomonas i 82% z enzymem z Bacteroides (SEQ ID NO.2), podczas gdy prezentuje zaledwie 49-52% identyczność z kilkoma roślinnymi izomerazami ksylozowymi. Nie są znane żadne doniesienia na temat roślinnej izomerazy ksylozowej, która jest aktywnie eksprymowana w drożdżach. Kontrastowo, w Przykładzie 3 w opisie prezentuje się, że izomeraza ksylozowa z Bacteroides nadaje eukariotycznej komórce gospodarza zdolność do izomeryzowania ksylozy do ksylulozy i wzrostu na ksylozie jako jedynym źródle węgla. Tym samym, korzystna sekwencja nukleotydowa koduje izomerazę ksylozową mającą sekwencję aminokwasową, która jest spokrewniona z sekwencją Piromyces jak zdefiniowano powyżej. Korzystna sekwencja nukleotydowa koduje grzybową izomerazę ksylozową (np. z Basidiomycete), korzystniej izomerazę ksylozową z grzyba beztlenowego, np. izomerazę ksylozową z grzyba beztlenowego, który należy do rodzin Neocallimastix, Caecomyces, Piromyces, Orpinomyces lub Ruminomyces. Alternatywnie, korzystna - 11 sekwencja nukleotydowa koduje bakteryjną izomerazę ksylozową, korzystnie z bakterii Gram-ujemnej, korzystniej izomerazę z klasy Bacteroides, lub z rodzaju Bacteroides, najkorzystniej z B. thetaiotaomicron (SEQ ID NO.2). [0034] By zwiększyć prawdopodobieństwo, że izomeraza ksylozowa jest eksprymowana w postaci aktywnej w eukariotycznej komórce gospodarza, takiej jak drożdże, sekwencję nukleotydową kodującą izomerazę ksylozową można przystosować do optymalizacji jej stosowania kodonów do tego dla eukariotycznej komórki gospodarza. Przystosowalność sekwencji nukleotydowej kodującej izomerazę ksylozową (lub inne enzymy według wynalazku, patrz poniżej) do wykorzystania kodonów dla komórki gospodarza można wyrazić jako wskaźnik adaptacji kodonów (CAI). Wskaźnik adaptacji kodonów zdefiniowano w opisie jako pomiar względnego przystosowania stosowania kodonów genu w kierunku stosowania kodonów genów eksprymowanych na wysokim poziomie. Względna przystosowalność (w) każdego kodonu oznacza stosunek wykorzystywania każdego kodonu, względem tego dla najpowszechniej występującego kodonu dla tego samego aminokwasu. Wskaźnik CAI jest definiowany jako średnia geometryczna tych względnych wartości przystosowalności. Wyklucza się niesynonimiczne kodony i kodony terminacji (zależne od kodu genetycznego). Wartości CAI oscylują w zakresie od 0 do 1, z wyższymi wartościami wskazującymi wyższe proporcje najpowszechniej występujących kodonów (patrz Sharp i Li, 1987, Nucleic Acids Research 15: 1281-1295; zob. również: Jansen i wsp., 2003, Nucleic Acids Res. 31(8):2242-51). Przystosowana sekwencja nukleotydowa korzystnie ma CAI rzędu co najmniej 0,2, 0,3, 0,4, 0,5, 0,6 lub 0,7. [0035] Komórka gospodarza do transformacji sekwencją nukleotydową kodującą izomerazę ksylozową jak opisano powyżej, korzystnie oznacza gospodarza zdolnego do aktywnego lub biernego transportu ksylozy do komórki. Komórka gospodarza korzystnie zawiera aktywną glikolizę. Komórka gospodarza może dodatkowo zawierać endogenny szlak pentozofosforanowy i może zawierać aktywność endogennej kinazy ksylulozowej, by ksyluloza izomeryzowana z ksylozy mogła być metabolizowana do pirogronianu. Gospodarz ponadto korzystnie zawiera enzymy do konwersji pirogronianu do pożądanego produktu fermentacji takiego jak etanol, kwas mlekowy, kwas 3-hydroksypropionowy, kwas akrylowy, kwas octowy, kwas bursztynowy, kwas cytrynowy, aminokwasy, 1,3-propanodiol, etylen, glicerol, antybiotyki ?-laktamowe i cefalosporyny. [0036] Korzystna komórka gospodarza oznacza komórkę gospodarza, która jest naturalnie zdolna do fermentacji alkoholowej, korzystnie, beztlenowej fermentacji alkoholowej. Komórka gospodarza dodatkowo korzystnie ma wysoką tolerancję na etanol, wysoką tolerancję na niskie pH (tj. zdolna do wzrostu w pH niższym niż 5, 4, 3 lub 2,5) i wobec kwasów organicznych jak kwas mlekowy, kwas octowy lub kwas mrówkowy i produktów rozkładu cukrów, takich jak furfural i hydroksymetylofurfural, i wysoką tolerancję na podwyższone temperatury. Dowolna z tych cech lub aktywności komórki gospodarza może być naturalnie obecna w komórce gospodarza lub może być wprowadzona lub modyfikowana za pomocą modyfikacji genetycznej. Odpowiednia komórka gospodarza oznacza eukariotyczny mikroorganizm jak np. grzyba, jednak najbardziej odpowiednie jako komórka - 12 gospodarza są drożdże lub grzyby nitkowate. [0037] Drożdże są definiowane w opisie jako mikroorganizmy eukariotyczne i obejmują wszystkie gatunki podgromady Eumycotina (Alexopoulos, C. J., 1962, w: Introductory Mycology, John Wiley & Sons, Inc., New York) które rosną przede wszystkim w postaci jednokomórkowej. Drożdże mogą rosnąć przez pączkowanie jednokomórkowej plechy lub przez podział organizmu. Korzystne drożdże jako komórki gospodarza należą do rodzajów Saccharomyces, Kluyveromyces, Candida, Pichia, Schizosaccharomyces, Hansenula, Kloeckera, Schwanniomyces i Yarrowia. Korzystnie drożdże są zdolne do fermentacji beztlenowej, bardziej korzystnie do beztlenowej fermentacji alkoholowej. [0038] Grzyby nitkowate są definiowane w opisie jako eukariotyczny mikroorganizmy, które obejmują wszystkie postaci nitkowate podgromady Eumycotina. Te grzyby charakteryzują się grzybnią wegetatywną złożoną z chityny, celulozy i innych złożonych polisacharydów. Grzyby nitkowate według wynalazku są morfologicznie, fizjologicznie i genetycznie różne od drożdży. Wegetatywny wzrost grzybów nitkowatych zachodzi przez wydłużenie strzępek, a katabolizm węgla większości grzybów nitkowatych jest bezwzględnie tlenowy. Korzystne grzyby nitkowate jako komórki gospodarza należą do rodzaju Aspergillus, Trichoderma, Humicola, Acremonium, Fusarium, i Penicillium. [0039] Przez lata czyniono sugestie dotyczące wprowadzania różnych organizmów do produkcji bio-etanolu z cukrów roślin uprawnych. W praktyce jednak we wszystkich głównych procesach produkcji bio-etanolu nadal kontynuowano stosowanie drożdży z rodzaju Saccharomyces w charakterze producenta etanolu. Jest to spowodowane wieloma atrakcyjnymi cechami gatunku Saccharomyces pod kątem procesów przemysłowych, tj., tolerancja na wysokie stężenia kwasów, etanolu i osmo-tolerancja, zdolność do wzrostu beztlenowego i oczywiście ich wysoka wydajność pod kątem fermentacji alkoholowej. Korzystne gatunki drożdży jako komórki gospodarza obejmują S. cerevisiae, S. bulderi, S. barnetti, S. exiguus; S. uvarum, S. diastaticus, K. lactis, K. marxianus, K. fragilis. [0040] Komórka gospodarza według wynalazku oznacza zatem komórkę gospodarza, która jest transformowana konstruktem kwasu nukleinowego zawierającym sekwencję nukleotydową kodującą izomerazę ksylozową jak zdefiniowano powyżej. Konstrukt kwasu nukleinowego zawierający sekwencję kodującą izomerazę ksylozową jest korzystnie zdolny do ekspresji izomerazy ksylozowej w komórce gospodarza. W tym celu konstrukt kwasu nukleinowego można konstruować jak opisano w np. WO 03/0624430. Komórka gospodarza może zawierać pojedynczą, ale korzystnie obejmuje wiele kopii konstruktu kwasu nukleinowego. Konstrukt kwasu nukleinowego można utrzymywać episomalnie, i stąd zawiera sekwencję do autonomicznej replikacji, taką jak sekwencja ARS. Odpowiednie episomalne konstrukty kwasu nukleinowego mogą opierać się na np. plazmidach drożdżowych 2? lub pKD1 (Fleer i wsp., 1991, Biotechnology 9:968-975). Korzystnie, jednak konstrukt kwasu nukleinowego ulega integracji w jednej lub większej liczbie kopii do genomu komórki gospodarza. Integracja do genomu komórki gospodarza może zachodzić losowo, za pomocą nieuprawnionej rekombinacji, ale korzystnie konstrukt kwasu nukleinowego jest integrowany do genomu komórki gospodarza za pomocą homologicznej - 13 rekombinacji, co jest dobrze znane w stanie techniki genetyki molekularnej grzybów (patrz np. WO 90/14423, EP-A-0 481 008, EP-A-0 635 574 i US 6,265,186). [0041] W pierwszym aspekcie wynalazku komórka gospodarza według wynalazku obejmuje modyfikację genetyczną, która zwiększa strumień szlaku pentozofosforanowego. Zwłaszcza, modyfikacja genetyczna powoduje zwiększony strumień nieoksydacyjnej części szlaku pentozofosforanowego. Modyfikacja genetyczna, która powoduje podwyższony strumień nieoksydacyjnej części szlaku pentozofosforanowego jest rozumiana w opisie jako modyfikacja, która zwiększa strumień o co najmniej współczynnik 1,1, 1,2, 1,5, 2, 5, 10 lub 20 w porównaniu do strumienia w szczepie, który jest genetycznie identyczny za wyjątkiem modyfikacji genetycznej powodującej podwyższony strumień. Strumień nieoksydacyjnej części szlaku pentozofosforanowego można mierzyć za pomocą hodowania modyfikowanego gospodarza na ksylozie jako jedynym źródle węgla, z określeniem swoistej szybkości zużywania ksylozy i odejmowaniem swoistej szybkości wytwarzania ksylitolu od swoistej szybkości zużywania ksylozy, jeśli wytwarzany jest jakikolwiek ksylitol. Jednak strumień nieoksydacyjnej części szlaku pentozofosforanowego jest proporcjonalny do szybkości wzrostu na ksylozie jako jedynym źródle węgla, korzystnie z szybkością beztlenowego wzrostu na ksylozie jako jedynym źródle węgla. Istnieje liniowa zależność pomiędzy szybkością wzrostu na ksylozie jako jedynym źródle węgla (?max) i strumieniem nieoksydacyjnej części szlaku pentozofosforanowego. Swoista szybkość zużywania ksylozy (Qs) jest równa szybkości wzrostu (?) podzielonej przez wydajność biomasy na cukrze (Yxs) ponieważ wydajność biomasy na cukrze jest stała (dla danego zestawu warunków: beztlenowe, pożywka wzrostowa, pH, genetyczne tło szczepu itp.; tj. Qs = ?/ Yxs). Tym samym zwiększony strumień nieoksydacyjnej części szlaku pentozofosforanowego można wydedukować na podstawie zwiększenia maksymalnej szybkości wzrostu w tych warunkach. [0042] Modyfikacje genetyczne, które podwyższają strumień dla szlaku pentozofosforanowego można wprowadzać w komórkach gospodarza na różne sposoby. Obejmują one np. osiąganie wyższych poziomów aktywności stanu ustalonego dla kinazy ksylulozowej i/lub jednego lub więcej enzymów nieoksydacyjnej części szlaku pentozofosforanowego i/lub obniżonego poziomu stanu ustalonego dla nieswoistej aktywności reduktazy aldozowej. Na te zmiany w poziomach aktywności stanu ustalonego może oddziaływać selekcja mutantów (spontanicznych lub indukowanych przez substancje chemiczne lub promieniowanie) i/lub technologia rekombinowanego DNA np. przez nadekspresję lub inaktywację, odpowiednio, genów kodujących enzymy lub czynniki regulujące te geny. [0043] W korzystnej komórce gospodarza modyfikacja genetyczna obejmuje nadekspresję co najmniej jednego enzymu (nieoksydacyjnej części) szlaku pentozofosforanowego. Korzystnie enzym wybiera się z grupy składającej się z enzymów kodujących izomerazę rybulozo-5fosforanową, epimerazę rybulozo-5-fosforanową, transketolazę i transaldolazę. Różne kombinacje enzymów (nieoksydacyjnej części) szlaku pentozofosforanowego mogą ulegać nadekspresji. Np. enzymy, które ulegają nadekspresji mogą oznaczać co najmniej enzymy izomerazy rybulozo-5-fosforanowej i epimerazy rybulozo-5-fosforanowej; lub co najmniej - 14 - enzymy izomerazy rybulozo-5-fosforanowej i transketolazy; lub co najmniej enzymy izomerazy rybulozo-5-fosforanowej i transaldolazy; lub co najmniej enzymy epimerazy rybulozo-5-fosforanowej i transketolazy; lub co najmniej enzymy epimerazy rybulozo-5fosforanowej i transaldolazy; lub co najmniej enzymy transketolazy i transaldolazy; lub co najmniej enzymy epimerazy rybulozo-5-fosforanowej, transketolazy i transaldolazy; lub co najmniej enzymy izomerazy rybulozo-5-fosforanowej, transketolazy i transaldolazy; lub co najmniej enzymy izomerazy rybulozo-5-fosforanowej, epimerazy rybulozo-5-fosforanowej i transaldolazy; lub co najmniej enzymy izomerazy rybulozo-5-fosforanowej, epimerazy rybulozo-5-fosforanowej i transketolazy. W jednym przykładzie wykonania wynalazku każdy z enzymów izomerazy rybulozo-5-fosforanowej, epimerazy rybulozo-5-fosforanowej, transketolazy i transaldolazy ulega nadekspresji w komórce gospodarza. Bardziej korzystna jest komórka gospodarza, w której modyfikacja genetyczna obejmuje co najmniej nadekspresję obu enzymów ? transketolazy i transaldolazy, jako że taka komórka gospodarza jest już zdolna do beztlenowego wzrostu na ksylozie. Faktycznie, w pewnych warunkach zaobserwowaliśmy, że komórki gospodarza nadeksprymujące jedynie transketolazę i transaldolazę mają już tę samą szybkość beztlenowego wzrostu na ksylozie, jaką mają komórki gospodarza, które nadeksprymują wszystkie cztery enzymy, tj. izomerazę rybulozo5-fosforanową, epimerazę rybulozo-5-fosforanową, transketolazę i transaldolazę. Ponadto komórki gospodarza nadeksprymujące oba enzymy izomerazy rybulozo-5-fosforanowej i epimerazy rybulozo-5-fosforanowej są preferowane względem komórek gospodarza nadeksprymujących jedynie izomerazę lub jedynie epimerazę, jako że nadekspresja zaledwie jednego z tych enzymów może powodować zaburzenia równowagi metabolicznej. [0044] Istnieją różne środki, dostępne w stanie techniki, do nadekspresji enzymów w komórkach gospodarza według wynalazku. Zwłaszcza, enzym może ulegać nadekspresji przez zwiększanie liczby kopii genu kodującego enzym w komórce gospodarza, np. przez integrowanie dodatkowych kopii genu w genomie komórki gospodarza, przez ekspresję genu z episomalnych występujących w wielu kopiach wektorów do ekspresji lub przez wprowadzenie episomalnego wektora do ekspresji, który zawiera liczne kopie genu. [0045] Alternatywnie nadekspresję enzymów w komórkach gospodarza według wynalazku można osiągnąć przy użyciu promotora, który nie jest natywny dla sekwencji kodującej enzym do nadekspresji, tj. promotora, który jest heterologiczny dla sekwencji kodującej, z którą jest on funkcjonalnie połączony. Chociaż promotor korzystnie jest heterologiczny dla sekwencji kodującej, z którą jest on funkcjonalnie połączony, jest również korzystne, gdy promotor jest homologiczny, tj. endogenny dla komórki gospodarza. Korzystnie heterologiczny promotor jest zdolny do produkowania wyższego poziomu stanu ustalonego dla transkryptu zawierającego sekwencję kodującą (lub jest zdolny do produkowania większej liczby cząsteczek transkryptu, tj. cząsteczek mRNA, na jednostkę czasu) niż promotor, który jest natywny dla sekwencji kodującej, korzystnie w warunkach, w których dostępna jest ksyloza lub ksyloza i glukoza jako źródła węgla, korzystniej jako główne źródła węgla (tj. więcej niż 50% dostępnych źródeł węgla składa się z ksylozy, lub ksylozy i glukozy), najkorzystniej jako jedynego źródła węgla. Odpowiednie promotory w tym kontekście obejmują zarówno konstytutywne, jak i indukowalne naturalne promotory, jak również - 15 modyfikowane promotory. Korzystny promotor do stosowania w wynalazku będzie dodatkowo niewrażliwy na represję katabolitu (glukozy) i/lub będzie korzystnie nie wymagać ksylozy do indukcji. [0046] Promotory mające te cechy są powszechnie dostępne i znane znawcy dziedziny. Odpowiednie przykłady takich promotorów obejmują np. promotory genów glikolitycznych, takich jak fosfofruktokinaza (PPK), izomeraza fosfotriozowa (TPI), dehydrogenaza gliceroaldehydo-3-fosforanowa (GPD, TDH3 lub GAPDH), kinaza pirogronianowa (PYK), kinaza fosfoglicerynianowa (PGK), promotory z drożdży lub grzybów nitkowatych; więcej szczegółów na temat takich promotorów z drożdży można znaleźć w WO 93/03159. Innymi użytecznymi promotorami są promotory genu kodującego rybosomalne białko, promotor genu laktazy (LAC4), promotory dehydrogenazy alkoholowej (ADH1, ADH4 i podobne) i promotor enolazy (ENO). Inne promotory, zarówno konstytutywne, jak i indukowalne, i enhancery lub sekwencje oddziałujące powyżej będą znane znawcy dziedziny. Promotory stosowane w komórkach gospodarza według wynalazku mogą być modyfikowane, jeśli jest to pożądane, dla oddziaływania na ich parametry kontroli. [0047] Sekwencja kodująca stosowana do nadekspresji enzymów korzystnie jest homologiczna do komórki gospodarza według wynalazku. Jednak można podobnie stosować sekwencje kodujące, które są heterologiczne wobec komórki gospodarza według wynalazku. [0048] Sekwencja nukleotydowa stosowana do nadekspresji izomerazy rybulozo-5fosforanowej w komórce gospodarza według wynalazku oznacza sekwencję nukleotydową kodującą polipeptyd o aktywności izomerazy rybulozo-5-fosforanowej, przy czym korzystnie polipeptyd ma sekwencję aminokwasową mającą co najmniej 50, 60, 70, 80, 90 lub 95% identyczności z SEQ ID NO. 4 lub przy czym sekwencja nukleotydowa jest zdolna do hybrydyzowania z sekwencją nukleotydową z SEQ ID NO. 12, w umiarkowanych warunkach, korzystnie w rygorystycznych warunkach. [0049] Sekwencja nukleotydowa stosowana do nadekspresji epimerazy rybulozo-5fosforanowej w komórce gospodarza według wynalazku oznacza sekwencję nukleotydową kodującą polipeptyd o aktywności epimerazy rybulozo-5-fosforanowej, przy czym korzystnie polipeptyd ma sekwencję aminokwasową mającą co najmniej 50, 60, 70, 80, 90 lub 95% identyczności z SEQ ID NO. 5 lub przy czym sekwencja nukleotydowa jest zdolna do hybrydyzowania z sekwencją nukleotydową z SEQ ID NO. 13, w umiarkowanych warunkach, korzystnie w rygorystycznych warunkach. [0050] Sekwencja nukleotydowa stosowana do nadekspresji transketolazy w komórce gospodarza według wynalazku oznacza sekwencję nukleotydową kodującą polipeptyd o aktywności transketolazy, przy czym korzystnie polipeptyd ma sekwencję aminokwasową mającą co najmniej 50, 60, 70, 80, 90 lub 95% identyczności z SEQ ID NO. 6 lub przy czym sekwencja nukleotydowa jest zdolna do hybrydyzowania z sekwencją nukleotydową z SEQ ID NO. 14, w umiarkowanych warunkach, korzystnie w rygorystycznych warunkach. [0051] Sekwencja nukleotydowa stosowana do nadekspresji transaldolazy w komórce gospodarza według wynalazku oznacza sekwencję nukleotydową kodującą polipeptyd - 16 o aktywności transaldolazy, przy czym korzystnie polipeptyd ma sekwencję aminokwasową mającą co najmniej 50, 60, 70, 80, 90 lub 95% identyczności z SEQ ID NO. 7 lub przy czym sekwencja nukleotydowa jest zdolna do hybrydyzowania z sekwencją nukleotydową z SEQ ID NO. 15, w umiarkowanych warunkach, korzystnie w rygorystycznych warunkach. [0052] Nadekspresja enzymu, w odniesieniu do wytwarzania enzymu w genetycznie modyfikowanej komórce gospodarza, oznacza, że enzym jest wytwarzany na wyższym poziomie swoistej aktywności enzymatycznej w porównaniu z niemodyfikowaną komórką gospodarza w identycznych warunkach. Oznacza to zwykle, że enzymatycznie aktywne białko (lub białka w przypadku enzymów o wielu podjednostkach) są wytwarzane w większych ilościach, lub raczej na wyższym poziomie stanu ustalonego w porównaniu z niemodyfikowaną komórką gospodarza w identycznych warunkach. Podobnie, oznacza to zwykle, że mRNA kodujący enzymatycznie aktywne białko jest wytwarzany w większych ilościach, lub ponownie, raczej na wyższym poziomie stanu ustalonego w porównaniu z niemodyfikowaną komórką gospodarza w identycznych warunkach. Nadekspresję enzymu określa się zatem korzystnie poprzez mierzenie poziomu swoistej aktywności enzymu w komórce gospodarza przy użyciu odpowiednich oznaczeń enzymatycznych, jak przedstawiono w opisie. Alternatywnie, nadekspresję enzymu można określić pośrednio przez określenie ilościowe swoistego poziomu stanu ustalonego enzymatycznego białka, np. przy użyciu przeciwciał swoistych dla enzymu, lub przez określenie ilościowe swoistego poziomu ustalonego dla mRNA kodującego enzym. To ostatnie może być szczególnie odpowiednie dla enzymów szlaku pentozofosforanowego, dla których oznaczenia enzymatyczne nie są łatwo dostępne jako że substraty dla enzymów nie są komercyjnie dostępne. Korzystnie w komórkach gospodarza według wynalazku, enzym do nadeksprymowania ulega nadekspresji o co najmniej współczynnik 1,1, 1,2, 1,5, 2, 5, 10 lub 20 w porównaniu ze szczepem, który jest genetycznie identyczny za wyjątkiem modyfikacji genetycznej powodującej nadekspresję. Należy rozumieć, że te poziomy nadekspresji mogą dotyczyć poziomu stanu ustalonego dla aktywności enzymu, poziomu stanu ustalonego dla białka enzymu, jak również poziomu stanu ustalonego dla transkryptu kodującego enzym. [0053] W drugim aspekcie wynalazku komórka gospodarza według wynalazku obejmuje modyfikację genetyczną, która zwiększa swoistą aktywność kinazy ksylulozowej. Korzystnie modyfikacja genetyczna powoduje nadekspresję kinazy ksylulozowej, np. poprzez nadekspresję sekwencji nukleotydowej kodującej kinazę ksylulozową. Gen kodujący kinazę ksylulozową może być endogenny względem komórki gospodarza, lub może oznaczać kinazę ksylulozową, która jest heterologiczna względem komórki gospodarza. Sekwencja nukleotydowa stosowana do nadekspresji kinazy ksylulozowej w komórce gospodarza według wynalazku oznacza sekwencję nukleotydową kodującą polipeptyd o aktywności kinazy ksylulozowej, przy czym korzystnie polipeptyd ma sekwencję aminokwasową mającą co najmniej 50, 60, 70, 80, 90 lub 95% identyczności z SEQ ID NO. 3 lub przy czym sekwencja nukleotydowa jest zdolna do hybrydyzowania z sekwencją nukleotydową z SEQ ID NO. 11, w umiarkowanych warunkach, korzystnie w rygorystycznych warunkach. [0054] Szczególnie korzystną kinazą ksylulozową jest kinaza ksylozowa, która jest powiązana - 17 z kinazą ksylulozową z Piromyces (xylB; zob. WO 03/0624430). Ta kinaza ksylulozowa z Piromyces jest faktycznie bardziej spokrewniona z kinazą prokariotyczną niż ze wszystkimi znanymi kinazami eukariotycznymi takimi jak kinaza drożdży (SEQ ID NO. 3). Eukariotyczne kinazy ksylulozowe wskazywano jako nieswoiste kinazy cukrów, które mają szeroki zakres substratów, który obejmuje ksylulozę. Kontrastowo, prokariotyczne kinazy ksylulozowe, z którymi w największym stopniu spokrewniona jest kinaza z Piromyces były wskazywane jako bardziej swoiste kinazy dla ksylulozy, tj. mające węższy zakres substratów. Tym samym, korzystniejsza sekwencja nukleotydowa do stosowania do nadekspresji kinazy ksylulozowej w komórce gospodarza według wynalazku oznacza sekwencję nukleotydową kodującą polipeptyd o aktywności kinazy ksylulozowej, przy czym korzystnie polipeptyd ma sekwencję aminokwasową mającą co najmniej 45, 50, 55, 60, 65, 70, 80, 90 lub 95% identyczności z SEQ ID NO. 17 lub przy czym sekwencja nukleotydowa jest zdolna do hybrydyzowania z sekwencją nukleotydową z SEQ ID NO. 18, w umiarkowanych warunkach, korzystnie w rygorystycznych warunkach. [0055] W komórkach gospodarza według wynalazku modyfikacja genetyczna, która zwiększa swoistą aktywność kinazy ksylulozowej może być łączona z dowolnymi z modyfikacji zwiększającymi strumień szlaku pentozofosforanowego jak opisano powyżej, ale ta kombinacja nie jest niezbędna dla wynalazku. Stąd komórka gospodarza według wynalazku zawierająca jedynie modyfikację genetyczną, która zwiększa swoistą aktywność kinazy ksylulozowej jest swoiście uwzględniona w wynalazku. Różne środki dostępne w stanie techniki do celów osiągnięcia i analizowania nadekspresji kinazy ksylulozowej w komórkach gospodarza według wynalazku są takie same jak opisano powyżej dla enzymów szlaku pentozofosforanowego. Korzystnie w komórkach gospodarza według wynalazku, kinaza ksylulozowa do nadeksprymowania ulega nadekspresji o co najmniej współczynnik 1,1, 1,2, 1,5, 2, 5, 10 lub 20 w porównaniu ze szczepem, który jest genetycznie identyczny za wyjątkiem modyfikacji genetycznej powodującej nadekspresję. Należy rozumieć, że te poziomy nadekspresji mogą dotyczyć poziomu stanu ustalonego dla aktywności enzymu, poziomu stanu ustalonego dla białka enzymu, jak również poziomu stanu ustalonego dla transkryptu kodującego enzym. [0056] W trzecim aspekcie wynalazku komórka gospodarza według wynalazku obejmuje modyfikację genetyczną, która zmniejsza nieswoistą aktywność reduktazy aldozowej w komórce gospodarza. Korzystnie, nieswoista aktywność reduktazy aldozowej ulega zmniejszeniu w komórce gospodarza przy udziale jednej lub większej liczby modyfikacji genetycznych, które obniżają ekspresję lub inaktywują gen kodujący nieswoistą reduktazę aldozową. Korzystnie, modyfikacje genetyczne zmniejszają lub inaktywują ekspresję każdej endogennej kopii genu kodującego nieswoistą reduktazę aldozową w komórce gospodarza. Komórki gospodarza mogą zawierać wiele kopii genów kodujących nieswoiste reduktazy aldozowe, w wyniku di-, poli- lub aneuploidii, i/lub komórka gospodarza może zawierać kilka różnych (izo)enzymów o aktywności reduktazy aldozowej, które różnią się sekwencją aminokwasową i które są ? każdy z nich ? kodowane przez inny gen. Również, w takich przypadkach korzystnie ekspresja każdego genu, który koduje nieswoistą reduktazę aldozową jest obniżona lub inaktywowana. Korzystnie, gen jest inaktywowany przez delecję co - 18 najmniej części genu lub przez zakłócenie genu, przy czym w tym kontekście pojęcie gen obejmuje również jakąkolwiek sekwencję niekodującą, położoną powyżej lub poniżej sekwencji kodującej, której (częściowa) delecja lub inaktywacja skutkuje obniżeniem ekspresji aktywności nieswoistej reduktazy aldozowej w komórce gospodarza. Sekwencja nukleotydowa kodująca reduktazę aldozową, której aktywność ma być zmniejszona w komórce gospodarza według wynalazku oznacza sekwencję nukleotydową kodującą polipeptyd o aktywności reduktazy aldozowej, przy czym korzystnie polipeptyd ma sekwencję aminokwasową mającą co najmniej 50, 60, 70, 80, 90 lub 95% identyczności z SEQ ID NO. 8 lub przy czym sekwencja nukleotydowa jest zdolna do hybrydyzowania z sekwencją nukleotydową z SEQ ID NO. 16, w umiarkowanych warunkach, korzystnie w rygorystycznych warunkach. [0057] W komórkach gospodarza według wynalazku modyfikacja genetyczna, która zmniejsza nieswoistą aktywność reduktazy aldozowej w komórce gospodarza może być łączona z dowolnymi z modyfikacji zwiększającymi strumień szlaku pentozofosforanowego i/lub z dowolnymi z modyfikacji zwiększającymi swoistą aktywność kinazy ksylulozowej w komórkach gospodarza jak opisano powyżej, ale te kombinacje nie są niezbędne dla wynalazku. Stąd komórka gospodarza według wynalazku zawierająca jedynie modyfikację genetyczną, która zmniejsza nieswoistą aktywność reduktazy aldozowej w komórce gospodarza jest swoiście uwzględniona w wynalazku. [0058] W dalszym aspekcie wynalazek dotyczy modyfikowanych komórek gospodarza, które są dalej przystosowane do wykorzystywania ksylozy poprzez selekcję mutantów, spontaniczną lub indukowaną (np. przez napromieniowanie lub chemikalia), dla uzyskania wzrostu na ksylozie, korzystnie na ksylozie jako jedynym źródle węgla, i korzystniej w warunkach beztlenowych. Selekcję mutantów można prowadzić przez seryjne pasażowanie hodowli, jak np. opisano w Kuyper i wsp. (2004, FEMS Yeast Res. 4: 655-664) lub za pomocą hodowli pod presją selekcyjną, w hodowli w chemostacie jak przedstawiono w Przykładzie 4 w opisie. [0059] W korzystnej komórce gospodarza według wynalazku co najmniej jedna z modyfikacji genetycznych opisanych powyżej, w tym modyfikacje uzyskane za pośrednictwem selekcji mutantów, nadaje komórce gospodarza zdolność do wzrostu na ksylozie w charakterze źródła węgla, korzystnie jako jedynym źródle węgla, i korzystnie w warunkach beztlenowych. Korzystnie modyfikowana komórka gospodarza nie produkuje zasadniczo żadnego ksylitolu, np. wytworzony ksylitol jest poniżej progu wykrywania, lub np. stanowi mniej niż 5, 2, 1, 0,5, lub 0,3% węgla zużywanego w przeliczeniu na mole. [0060] Korzystnie modyfikowana komórka gospodarza ma zdolność do wzrostu na ksylozie jako jedynym źródle węgla z szybkością co najmniej 0,05, 0,1, 0,2, 0,25 lub 0,3 godz. -1 w warunkach tlenowych, lub, w stosownych przypadkach, z szybkością co najmniej 0,03, 0,05, 0,07, 0,08, 0,09, 0,1, 0,12, 0,15 lub 0,2 godz.-1 w warunkach beztlenowych. Korzystnie modyfikowana komórka gospodarza ma zdolność do wzrostu na mieszaninie glukozy i ksylozy (w stosunku wagowym 1:1) jako jedynym źródle węgla z szybkością co najmniej 0,05, 0,1, 0,2, 0,25 lub 0,3 godz.-1 w warunkach tlenowych, lub, w stosownych przypadkach, - 19 z szybkością co najmniej 0,03, 0,05, 0,1, 0,12, 0,15, lub 0,2 godz.-1 w warunkach beztlenowych. [0061] Korzystnie, modyfikowana komórka gospodarza ma swoistą szybkość zużywania ksylozy rzędu co najmniej 346, 350, 400, 500, 600, 750, lub 1000 mg ksylozy/g komórek/godz. Korzystnie, modyfikowana komórka gospodarza ma wydajność produktu fermentacji (takiego jak etanol) na ksylozie która oznacza co najmniej 55, 60, 70, 80, 85, 90, 95 lub 98% wydajności komórki gospodarza dla produktu fermentacji (takiego jak etanol) na glukozie. Korzystniej, wydajność modyfikowanej komórki gospodarza dla produktu fermentacji (takiego jak etanol) na ksylozie jest równa wydajności komórki gospodarza dla produktu fermentacji (takiego jak etanol) na glukozie. Podobnie, wydajność biomasy modyfikowanej komórki gospodarza na ksylozie wynosi korzystnie co najmniej 55, 60, 70, 80, 85, 90, 95 lub 98% wydajności biomasy komórki gospodarza na glukozie. Korzystniej, wydajność biomasy modyfikowanej komórki gospodarza na ksylozie jest równa wydajności biomasy komórki gospodarza na glukozie. Jest zrozumiałym, że przy porównywaniu wydajności na glukozie i ksylozie obie wydajności są porównywane w warunkach tlenowych lub obie w warunkach beztlenowych. [0062] W korzystnym aspekcie modyfikowana komórka gospodarza według wynalazku oznacza komórkę gospodarza do wytwarzania etanolu. W kolejnym aspekcie wynalazek dotyczy transformowanej komórki gospodarza do wytwarzania produktów fermentacji innych niż etanol. Takie nieetanolowe produkty fermentacji obejmują z zasady wszelkie chemikalia luzem lub rozdrobione, które mogą zostać wytworzone przez eukariotyczny mikroorganizm, taki jak drożdże lub grzyb nitkowaty. Taki produkty fermentacji obejmują np. kwas mlekowy, kwas 3-hydroksypropionowy, kwas akrylowy, kwas octowy, kwas bursztynowy, kwas cytrynowy, aminokwasy, 1,3-propanodiol, etylen, glicerol, antybiotyki ?-laktamowe i cefalosporyny. Korzystna modyfikowana komórka gospodarza według wynalazku do wytwarzania nieetanolowych produktów fermentacji oznacza komórkę gospodarza, która zawiera modyfikację genetyczną, która skutkuje obniżeniem aktywności dehydrogenazy alkoholowej. [0063] W dalszym aspekcie wynalazek dotyczy procesów fermentacji, w których modyfikowane komórki gospodarza według wynalazku są stosowane do fermentacji źródła węgla, zawierającego źródło ksylozy, takie jak ksyloza. Oprócz źródła ksylozy źródło węgla w pożywce fermentacyjnej może również zawierać źródło glukozy. Źródło ksylozy lub glukozy może oznaczać ksylozę lub glukozę jako takie lub może oznaczać dowolny węglowodanowy oligo- lub polimer zawierający jednostki ksylozy lub glukozy, takie jak np. lignoceluloza, ksylany, celuloza, skrobia i podobne. Dla uwolnienia jednostek ksylozy lub glukozy z takich węglowodanów, można dodawać odpowiednie karbohydrazy (takie jak ksylanazy, glukanazy, amylazy i podobne) do pożywki do fermentacji lub mogą one być wytwarzane przez modyfikowane komórki gospodarza. W tym ostatnim przypadku modyfikowana komórka gospodarza może być genetycznie modyfikowana, do celów produkcji i wydzielania takich karbohydraz. Dodatkową zaletą stosowania oligo- lub polimerowych źródeł glukozy jest to, że umożliwia to utrzymanie niskiego (niższego) - 20 stężenia wolnej glukozy podczas fermentacji, np. przy użyciu ograniczających szybkość ilości karbohydraz. To z kolei będzie zapobiegać represji systemów wymaganych do metabolizmu i transportu różnych od glukozy cukrów, takich jak ksyloza. W korzystnym procesie modyfikowane komórki gospodarza fermentują zarówno ksylozę, jak i glukozę, korzystnie równocześnie, w którym to przypadku korzystnie stosuje się modyfikowane komórki gospodarza, które są niewrażliwe na represję przez glukozę, by zapobiec wzrostowi dwufazowemu. Oprócz źródła ksylozy (i glukozy) w charakterze źródła węgla, pożywka do fermentacji będzie dodatkowo zawierać odpowiedni składnik, wymagany do wzrostu modyfikowanej komórki gospodarza. Kompozycje pożywek do fermentacji, do celów wzrostu mikroorganizmów, takich jak drożdże, są dobrze znane w stanie techniki. [0064] Proces fermentacji oznacza proces do wytwarzania produktu fermentacji, takiego jak np. etanol, kwas mlekowy, kwas 3-hydroksypropionowy, kwas akrylowy, kwas octowy, kwas bursztynowy, kwas cytrynowy, aminokwasy, 1,3-propanodiol, etylen, glicerol, antybiotyki ?laktamowe, takie jak penicylina G lub penicylina V i ich ulegające fermentacji pochodne, i cefalosporyny. Proces fermentacji może oznaczać tlenowy lub beztlenowy proces fermentacji. Beztlenowy proces fermentacji jest definiowany w opisie jako proces fermentacji prowadzony pod nieobecność tlenu lub w którym zasadniczo nie zużywa się żadnego tlenu, korzystnie zużywa się mniej niż 5, 2,5 lub 1 mmol/l/godz., bardziej korzystnie 0 mmol/l/godz. (tj. zużycie tlenu nie jest wykrywalne), i przy czym cząsteczki organiczne służą zarówno jako donory elektronów, jak i akceptory elektronów. Pod nieobecność tlenu NADH wytworzonego podczas glikolizy i tworzenia biomasy nie można utlenić na drodze fosforylacji oksydacyjnej. By rozwiązać ten problem wiele mikroorganizmów wykorzystuje pirogronian lub jedną z jego pochodnych jako akceptory elektronów i wodoru, odtwarzając tym samym NAD+. Stąd w korzystnym beztlenowym procesie fermentacji pirogronian jest stosowany jako akceptor elektronu (i wodoru) i jest redukowany do produktów fermentacji takich jak etanol, kwas mlekowy, kwas 3-hydroksypropionowy, kwas akrylowy, kwas octowy, kwas bursztynowy, kwas cytrynowy, aminokwasy, 1,3-propanodiol, etylen, glicerol, antybiotyki ?-laktamowe i cefalosporyny. [0065] Proces fermentacji jest korzystnie prowadzony w temperaturze, która jest optymalna dla modyfikowanych komórek gospodarza. Stąd, dla większości komórek drożdży lub grzybowych komórek gospodarza, proces fermentacji prowadzi się w temperaturze, która jest niższa niż 42°C, korzystnie niższa niż 38°C. Dla komórek drożdży lub komórek gospodarza grzyba nitkowatego, proces fermentacji jest korzystnie prowadzony w temperaturze, która jest niższa niż 35, 33, 30 lub 28°C i w temperaturze, która jest wyższa niż 20, 22 lub 25°C. [0066] Korzystny proces oznacza proces do wytwarzania etanolu, przy czym proces obejmuje etapy: (a) fermentowania pożywki zawierającej źródło ksylozy z udziałem modyfikowanej komórki gospodarza jak zdefiniowano powyżej, przy czym komórka gospodarza fermentuje ksylozę do etanolu, i opcjonalnie, (b) odzyskiwania etanolu. Pożywka do fermentacji może również zawierać źródło glukozy, które jest również fermentowane do etanolu. W procesie objętościowa wydajność etanolu wynosi korzystnie co najmniej 0,5, 1,0, 1,5, 2,0, 2,5, 3,0, 5,0 - 21 lub 10,0 g etanolu na litr na godzinę. Wydajność etanolu na ksylozie i/lub glukozie w procesie korzystnie wynosi co najmniej 50, 60, 70, 80, 90, 95 lub 98%. Wydajność etanolu jest definiowana w opisie jako odsetek teoretycznej maksymalnej wydajności, która, dla glukozy i ksylozy wynosi 0,51 g etanolu na g glukozy lub ksylozy. [0067] W dalszym aspekcie wynalazek dotyczy procesu do wytwarzania produktu fermentacji wybranego z grupy składającej się z kwasu mlekowego, kwasu 3-hydroksypropionowego, kwasu akrylowego, kwasu octowego, kwasu bursztynowego, kwasu cytrynowego, aminokwasów, 1,3-propanodiolu, etylenu, glicerolu, antybiotyków ?-laktamowych i cefalosporyn. Proces korzystnie obejmuje etapy (a) fermentowania pożywki zawierającej źródło ksylozy z udziałem modyfikowanej komórki gospodarza jak zdefiniowano w opisie powyżej, przy czym komórka gospodarza fermentuje ksylozę do produktu fermentacji, i opcjonalnie, (b) odzyskiwania produktu fermentacji. W korzystnym procesie pożywka również zawiera źródło glukozy. Modyfikacje genetyczne [0068] Do celów nadekspresji enzymów w komórkach gospodarza według wynalazku, jak opisano powyżej, jak również dla dodatkowej modyfikacji genetycznej komórek gospodarza, korzystnie drożdży, komórki gospodarza są transformowane różnymi konstruktami kwasu nukleinowego według wynalazku, sposobami dobrze znanymi w stanie techniki. Takie sposoby są np. znane ze standardowych podręczników, takich jak Sambrook i Russel (2001) ?Molecular Cloning: A Laboratory Manual (wydanie 3.), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, lub F. Ausubel i wsp., eds., ?Current protocols in molecular biology?, Green Publishing and Wiley Interscience, New York (1987). Sposoby transformacji i modyfikacji genetycznej grzybowych komórek gospodarza są znane z np. EPA-0 635 574, WO 98/46772, WO 99/60102 i WO 00/37671. [0069] Promotory do stosowania w konstruktach kwasu nukleinowego do celów nadekspresji enzymów w komórkach gospodarza według wynalazku zostały opisane powyżej. W konstruktach kwasu nukleinowego do nadekspresji, koniec 3?- sekwencji kwasu nukleinowego kodującego enzym(y) jest korzystnie funkcjonalnie połączony z sekwencją terminatora transkrypcji. Korzystnie sekwencja terminatora jest funkcjonalna w komórce gospodarza z wyboru, takiej jak np. wybrany gatunek drożdży. W którymkolwiek przypadku, wybór terminatora nie ma krytycznego znaczenia; może on np. pochodzić z dowolnego genu drożdży, chociaż niekiedy funkcjonalne są terminatory z nie-drożdżowego, eukariotycznego genu. Sekwencja terminacji transkrypcji dodatkowo korzystnie obejmuje sygnał poliadenylacji. [0070] Opcjonalnie, marker selekcyjny może być obecny w konstrukcie kwasu nukleinowego. Według opisu pojęcie ?marker? dotyczy genu kodującego cechę lub fenotyp, który umożliwia selekcję, lub badania przesiewowe pod kątem komórki gospodarza zawierającej marker. Gen markera może oznaczać gen oporności na antybiotyk, przy czym można stosować odpowiedni antybiotyk do prowadzenia selekcji transformowanych komórek z komórek, które nie są transformowane. Przykłady odpowiednich markerów antybiotykooporności obejmują np. reduktazę dihydrofolianową, higromycyno-B-fosfotransferazę, 3?-O-fosfotransferazę II - 22 (oporność na kanamycynę, neomycynę i G418). Chociaż markery antybiotykooporności mogą być najbardziej dogodne do transformacji poliploidalnych komórek gospodarza, korzystnie jednak stosuje się markery inne niż związane z antybiotykoopornością, takie jak markery auksotroficzne (URA3, TRP1, LEU2) lub gen TPI z S. pombe (opisany przez Russell P R, 1985, Gene 40: 125-130). W korzystnym przykładzie wykonania komórki gospodarza transformowane konstruktami kwasu nukleinowego są wolne od genu markerowego. Sposoby konstruowania rekombinowanych, wolnych od genu markerowego drobnoustrojowych komórek gospodarza ujawniono w EP-A-0 635 574 i opierają się one na stosowaniu dwukierunkowych markerów, takich jak gen amdS A. nidulans (acetamidaza) lub genów drożdży URA3 i LYS2. Alternatywnie, można inkorporować nadający się do badań przesiewowych marker taki jak białko zielonej fluorescencji, lacZ, lucyferaza, chloramfenikol acetylotransferaza, beta-glukuronidaza do konstruktów kwasu nukleinowego według wynalazku, co umożliwi badania przesiewowe transformowanych komórek. [0071] Opcjonalne dalsze elementy, które mogą być obecne w konstruktach kwasu nukleinowego według wynalazku obejmują, nieograniczająco, jedną lub więcej z sekwencji liderowych, enhancerów, czynników integracji i/lub genów reporterowych, sekwencji intronów, centromerów, telomerów i/lub sekwencji mocowania do macierzy (MAR). Konstrukty kwasu nukleinowego według wynalazku mogą dodatkowo zawierać sekwencję do autonomicznej replikacji, taką jak sekwencja ARS. Odpowiednie episomalne konstrukty kwasu nukleinowego mogą opierać się na np. plazmidach drożdżowych 2? lub pKD1 (Fleer i wsp., 1991, Biotechnology 9:968-975). Alternatywnie konstrukt kwasu nukleinowego może zawierać sekwencje na potrzeby integracji, korzystnie przez homologiczną rekombinację. Takie sekwencje mogą zatem być sekwencjami homologicznymi do miejsca docelowego, do celów integracji do genomu w komórce gospodarza. Konstrukty kwasu nukleinowego według wynalazku można zapewniać w sposób znany per se, co wiąże się na ogół z technikami takimi jak cięcie restrykcyjne i łączenie kwasów nukleinowych/sekwencji kwasu nukleinowego, do których odniesienia są w standardowych podręcznikach, takich jak Sambrook i Russel (2001) ?Molecular Cloning: A Laboratory Manual (wydanie 3.), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, lub F. Ausubel i wsp., eds., ?Current protocols in molecular biology?, Green Publishing and Wiley Interscience, New York (1987). [0072] Sposoby do inaktywacji i przerywania ciągłości genu w drożdżach lub grzybach nitkowatych są dobrze znane w stanie techniki (patrz np. Fincham, 1989, Microbiol Rev. 53(1):148-70 i EP-A-0 635 574). Opis figur [0073] Fig. 1. Typowy wykres beztlenowego wzrostu szczepu RWB 212 w fermentorach na syntetycznej pożywce z 2% (wag./obj.) ksylozą jako źródłem węgla, wykonywane w dwóch powtórzeniach doświadczenia różniły się o mniej niż 5%. Panel A: ksyloza (?), etanol (O), glicerol (?) i łączny CO2 wytworzony na litr, jak dedukowano na podstawie analizy gazów (-). Panel B: sucha masa (?), octan (O), ksylitol (?), bursztynian (?), mleczan (?): - 23 - Fig. 2. Typowy wykres beztlenowego wzrostu szczepu RWB 212 w fermentorach na syntetycznej pożywce z 2% (wag./obj.) ksylozą i 2% (wag./obj.) ksylozą jako źródłem węgla, wykonywane w dwóch powtórzeniach doświadczenia różniły się o mniej niż 5%. Panel A: glukoza (?), ksyloza (O), etanol (?), glicerol (?) i łączny CO 2 wytworzony na litr, jak dedukowano na podstawie analizy gazów (-). Panel B: sucha masa (?), octan (O), ksylitol (?), mleczan (?) bursztynian (?). Przykłady 1. Materiały i sposoby 1.1. Konstrukcja plazmidu [0074] Dla zintegrowania promotora TPI1 przed naszymi docelowymi genami, skonstruowano kilka plazmidów. Najpierw wycięto promotor TPI1 jako fragment XhoIEcoRV z pYX012-Aat (A.A. Winkler, pochodna pYX012 (R&D Systems, Minneapolis, MN, USA)) i ligowano do pUG6 [3] ciętego SalI-PvuII. Dało to pUG6PTPI, który można było następnie stosować do PCR kasety integracyjnej Kanlox-PTPI. [0075] W przypadkach, gdy domniemane ORF?s były bardzo blisko ATG docelowych genów, klonowano te geny do pUG6PTPI. Izolowano 0,8 kpz fragment RPE1 i 2,3 kpz fragment TKL1 z żelu i cięto EcoRI i XhoI (obecnymi w starterach, patrz Tabela 3) i ligowano do pUG6PTPI ciętego EcoRI-SalI, co dało pUG6PTPI-RPE1 i pUG6PTPI-TKL1. [0076] Dla zwiększenia aktywności ksylulokinazy gen XKS1 amplifikowano w PCR jako fragment SpeI-SalI (miejsca w starterach, patrz Tabela 3) i klonowano do p415ADH [4] ciętego XbaI-XhoI, co dało p415ADHXKS. [0077] Stosowano endonukleazy restrykcyjne (New England Biolabs, Beverly, MA, USA i Roche, Basel, Szwajcaria) i ligazę DNA (Roche) stosowano według specyfikacji producentów. Izolację plazmidu z E. coli prowadzono za pomocą zestawu Qiaprep spin miniprep kit (Qiagen, Hilden, Niemcy). Fragmenty DNA rozdzielano na 1% żelu agarozowym (Sigma, St. Louis, MO, USA) w 1xTBE [5]. Izolację fragmentów z żelu prowadzono za pomocą zestawu do ekstrakcji z żelu Qiaquick gel extraction kit (Quiagen). Amplifikację RPE1, TKL1 i XKS1 prowadzono za pomocą polimerazy DNA VentR (New England Biolabs) według specyfikacji producenta. Matrycą było chromosomalne DNA z CEN.PK113-7D (wt). Reakcję łańcuchowej polimerazy (PCR) prowadzono w termocyklerze Biometra TGradient (Biometra, Göttingen, Niemcy) przy poniższych ustawieniach: 30 cykli po 1 min hybrydyzacji w temp. 60°C, 3 min wydłużania w temp. 75°C i 1 min denaturowanie w temp. 94°C. 1.2 Szczepy i pożywki [0078] Szczep Saccharomyces cerevisiae stosowany w tym badaniu to RWB212 (MATA ura3-52 leu2-112 loxP-PTPI::(-266 ,-1)TAL1 gre3::hphMX pUGPTPI-TKL1 pUGPTPIRPE1 KanloxP-PTPI::(-?,-1)RKI1), który pochodzi z CEN.PK102-3A (MATA ura3-52 leu2112). [0079] Podczas konstruwania szczepy utrzymywano na złożonej pożywce (YP: 10 g l -1 - 24 ekstrakt drożdżowy (BD Difco), 20 g l-1 pepton (BD Difco)) lub syntetycznej pożywce (MY) [6] z dodatkiem glukozy (2%) jako źródła węgla (YPD lub MYD) i 1,5% agaru w przypadku płytek. Po transformacji selekcjonowano integranty przez wylewanie na płytki z YPD zawierające genetycynę (G418) (Invitrogen/GIBCO) po 200 ?g/ml lub hygromycynę B (Roche Diagnostics GmbH, Mannheim, Niemcy) po 300 ?g/ml. Po transformacji plazmidami szczepy wylewano na płytki z MYD. Transformacje drożdży prowadzono według Gietz i Woods [7]. [0080] Plazmidy amplifikowano w szczepie Escherichia coli XL-1 blue (Stratagene, La Jolla, CA, USA). Transformację prowadzono według Inoue i wsp. [8]. E. coli hodowano na płytkach z LB (Luria-Bertani) lub w ciekłej pożywce TB (Terrific Broth) dla izolacji plazmidów [5]. 1.3 Konstrukcja szczepu [0081] Dla integracji TAL1 i RKI1 promotora TPI1 5? otwartą ramkę odczytu uzyskiwano amplifikując fragment PCR z markerem KanMX i promotorem TPI1 i kierując to do docelowej lokalizacji za pomocą homologicznych końców. PCR wykonywano za pomocą polimerazy DNA Taq (Amersham Pharmacia, Piscataway, USA) według specyfikacji producentów. Matrycą było pUG6PTPI z PTALdisA i PTALdisB lub PRKIdisA i PRKIdisB (Tabela 3) jako starterami. [0082] W przypadku TKL1 i RPE1, plazmidy pUG6PTpI-TKL1 i pUG6PTPI-RPE1 liniowano odpowiednio PvuII i SalI i integrowano do genomu. Prawidłową integrację konstruktów weryfikowano za pomocą PCR na koloniach, ze starterem TAL1 intern + KanA dla TAL1 i PTPI + ?intern? dla TKL1, RPE1 i RPI1. Startery wewnętrzne ?Intern? ulegały hybrydyzacji poniżej integrowanych konstruktów, podczas gdy starter P TPI hybrydyzował przy 3? końcu promotora TPI1. [0083] Po integracji konstruktu marker KanMX usuwano za pomocą rekombinazy Cre. W tym celu szczepy transformowano pSH47 [3]. Kolonie z plazmidem zawieszano ponownie w YP z 1% galaktozą i inkubowano przez 1 godzinę w temp. 30°C. Następnie około 200 komórek wylewano na płytki z YPD. Uzyskane kolonie sprawdzano pod kątem utraty markera KanMX i pSH47 (URA3). [0084] Ponadto zastąpiono gen GRE3 kasetą hphMX z pAG32, nadając oporność na higromycynę [9]. Kasetę hphMX amplifikowano przy użyciu oligo?s 5?gre3::Kanlox i 3?gre3::Kanlox. Prawidłową integrację potwierdzano przy użyciu PCR z 5?GRE3 + KanA i 3?GRE3 + KanB (Tabela 3). KanA i KanB hybrydyzują odpowiednio do promotora TEF z A. gossipi i terminatora, podczas gdy inne startery hybrydyzują na zewnątrz otwartej ramki odczytu GRE3. [0085] PCR na koloniach prowadzono za pomocą polimerazy DNA Taq (Amersham Pharmacia, Piscataway, USA) według specyfikacji producentów. Jako szablon komórki zawieszano w 2,5 ?l 0,02 M NaOH do których dodawano mieszaninę reakcyjną PCR. PCR prowadzono w termocyklerze Biometra TGradient (Biometra, Göttingen, Niemcy) przy poniższych ustawieniach: 30 cykli po 1 min hybrydyzacji w temp. 60°C, 3 min wydłużania - 25 w temp. 72°C i 1 min denaturowanie w temp. 94°C. [0086] Uzyskany szczep, RWB212 (MATA ura3-52 leu2-112 loxP-PTPI::(-266,-1)TAL1 gre3::hphMX pUGPTPI-TKL1 pUGPTPI-RPE1 KanloxP-PTPI::(-?,-1)RKI1), był następnie transformowany pAKX002, wielokopijnym wektorem zawierającym Piromyces sp. E2 XylA za promotorem TPI1, jak również p415ADHXKS. Dało to RWB217 (MATA ura3-52 leu2112 loxP-PTPI::(-266,-1)TAL1 gre3::hphMX pUGPTPI-TKL1 pUGPTPI-RPE1 KanloxPPTPI::(-?,-1)RKI1 {pAKX002, p415ADHXKS}). 1.4. Utrzymywanie szczepu [0087] Hodowle podstawowe hodowano w temp. 30°C w wytrząsanych kolbach, na syntetycznej pożywce [6] z dodatkiem 20 g glukozy l-1. Gdy osiągnięto fazę stacjonarną dodawano jałowy glicerol do 30% (obj./obj.), i przechowywano porcje po 2-ml w jałowych fiolkach w temp. -80°C. 1.5 Prowadzenie hodowli i pożywki [0088] Prowadzenie hodowli w wytrząsanych kolbach zachodziło w temp. 30°C w syntetycznej pożywce [6]. Dostosowywano pH pożywki do 6,0 za pomocą 2 M KOH przed wyjałowieniem. Hodowle wstępne otrzymywano przez zaszczepienie 100 ml pożywki zawierającej 20 g l-1 ksylozy w 500 ml wytrząsanej kolbie, zamrożoną hodowlą podstawową. Po upływie 24 do 48 godz. inkubacji w temp. 30°C w wytrząsarce orbitalnej (200 rpm), hodowlę tę stosowano do zaszczepiania hodowli w kolbach do wytrząsania lub hodowli w fermentorze. Syntetyczną pożywkę do prowadzenia hodowli beztlenowych uzupełniano o 0,01 g l-1 ergosterolu i 0,42 g l-1 Tweenu 80 rozpuszczonego w etanolu [10,11], co dało 1113 mM etanolu w pożywce. 1.6 Beztlenowe prowadzenie hodowli okresowych w fermentorach [0089] Beztlenowe hodowle okresowe prowadzono w 2-litrowych laboratoryjnych fermentorach (Applikon, Schiedam, Holandia) wyposażonych w przewody Norprene, o objętości roboczej 1,5 litra, w temp. 30°C i w pH 5,0. Hodowle mieszano przy 800 rpm i przepłukiwano 0,5 l min-1 azotu o wysokiej czystości (<5 ppm tlenu). Syntetyczną pożywkę uzupełniano o czynniki beztlenowego wzrostu ergosterol i Tween 80 (odpowiednio 0,01 i 0,42 g l-1) jak również 100 ?l l-1 silikonowego środka przeciwko pienieniu (BDH, Poole, UK). 1.7 Określenie suchej masy hodowli [0090] Próbki hodowli (10,0 ml) filtrowano przez wstępnie zważone filtry z nitrocelulozy (rozmiar porów 0,45 ?m; Gelman laboratory, Ann Arbor, USA). Po usunięciu pożywki filtry przemywano wodą demineralizowaną i osuszano w piecu mikrofalowym (Bosch, Stuttgart, Niemcy) przez 20 min przy 360 W i ważono. Określenia wykonywano jako powtórzenie różniły się o mniej niż 1%. 1.8 Analiza gazów [0091] Gaz odlotowy oziębiano w skraplaczu (2°C) i osuszano suszarką Permapure typu MD- - 26 110-48P-4 (Permapure, Toms River, USA). Określano stężenia O2 i CO2 za pomocą analizatora NGA 2000 (Rosemount Analytical, Orrville, USA). Określano szybkość przepływu gazu odlotowego i swoiste szybkości zużywania tlenu i wytwarzania dwutlenku węgla, jak opisano wcześniej [12,13]. Przy obliczaniu tych szybkości swoistych dla biomasy dokonywano korekty zmian objętości powodowanych przez pobieranie próbek hodowli. 1.9 Analiza metabolitów [0092] Wykrywano glukozę, ksylozę, ksylitol, kwasy organiczne, glicerol i etanol za pomocą analizy HPLC na aparacie Waters Alliance 2690 HPLC (Waters, Milford, USA) zawierającym kolumnę Biorad HPX 87H (Biorad, Hercules, USA). Kolumnę eluowano w temp. 60°C 0,5 g l-1 H2SO4 z szybkością przepływu 0,6 ml min-1. Detekcję prowadzono przy użyciu detektora Waters 2410 z współczynnikiem załamania światła i detektora Waters 2487 UV. Ksylulozę określano enzymatycznie w poniższy sposób. Mieszanina reakcyjna składała się z buforu 100 mM Tris-HCl (pH 7,5) z 10 mM MgCl2, 0,30 mM NADH i odpowiedniej ilość próbki (1 ml całkowitej objętości); oznaczenie rozpoczynano przez dodanie 0,2 U dehydrogenazy sorbitolowej (Sigma, St Louis, USA). Stężenie ksylulozy obliczano przy użyciu współczynnika absorpcji 6,3 mM-1 cm-1 dla NADH. 1.10. Odzyskiwanie węgla i odparowywanie etanolu [0093] Odzyskiwanie węgla obliczano jako węgiel w utworzonych produktach podzielony przez całkowitą ilość zużytego węgla w cukrach i opierano na zawartości węgla w biomasie rzędu 48%. By skorygować odparowanie etanolu podczas fermentacji, założono, że ilość wytworzonego etanolu jest równa zmierzonemu kumulacyjnemu wytwarzaniu CO2 minus wytwarzanie CO2 do którego doszło na skutek syntezy biomasy (5,85 mmol CO2 na gram biomasy [14]) i CO2 powiązany z tworzeniem octanu, jak opisano wcześniej [2]. 1.11 Analiza mikromacierzowa [0094] Pobieranie próbek komórek z chemostatów, przygotowanie sondy i hybrydyzacje do mikromacierzy Affymetrix Genechip? wykonywano jak opisano wcześniej [15]. Wyniki dla każdego z warunków wzrostu wyprowadzano na podstawie trzech niezależnie hodowanych powtórzeń. 1.12. Pozyskiwanie danych i analiza [0095] Pozyskiwanie i określenie ilościowe obrazów macierzy i filtrowanie danych prowadzono przy użyciu pakietów oprogramowania Affymetrix: Microarray Suite v5.0, MicroDB v3.0 i Data Mining Tool v3.0. [0096] Przed wykonaniem porównania wszystkie macierze globalnie skalowano do wartości docelowej 150 przy użyciu uśrednionego sygnału ze wszystkich funkcji genów przy użyciu Microarray Suite v5.0. Z 9,335 transkryptów na macierzach YG-S98 zastosowano filtr, dla ekstrahowania 6,383 drożdżowych otwartych ramek odczytu, na podstawie których stwierdzono obecność 6,084 różnych genów. Niezgodność ta była spowodowana tym, że geny były reprezentowane więcej niż raz, gdy stosowano suboptymalny zestaw sond przy projektowaniu macierzy. - 27 [0097] By przedstawić zróżnicowanie w trzykrotnych pomiarach, obliczano współczynnik zmienności (C.V.; odchylenie standardowe podzielone przez średnią) jak opisano wcześniej w Boer i wsp. [16]. [0098] Do dalszych analiz statystycznych stosowano nakładkę Microsoft Excel do analiz określania istotności mikromacierzy (SAM v1.12) [17] dla potencjalnego porównywania parami ośmiu zestawów danych. O genach uważano, że mają zmienioną ekspresję, jeśli zostały określone jako istotnie zmienione przez SAM (oczekiwana mediana współczynnika fałszywych odkryć (FDR) rzędu 1%) o co najmniej 2-krotność z każdego z warunków. Następnie wykonywano grupowanie hierarchiczne uzyskanych zestawów o istotne zmienionych poziomach ekspresji, za pomocą Genespring (Silicon Genetics). 1.13 Oznaczenia enzymów [0099] Aktywność izomerazy ksylozowej szacowano w temp. 37°C w mieszaninie reakcyjnej zawierającej 50 mM bufor fosforanowy (pH 7,0), 10 mM ksylozę, 10 mM MgCl2 i odpowiednią ilość wolnego od komórek ekstraktu. Ilość utworzonej ksylulozy określano sposobem cysteino-karbazolowym (9). Alternatywnie aktywność izomerazy ksylozowej szacowano w temp. 30°C w oznaczeniu enzymatycznym opracowanym przez KerstersHildersson i wsp. (Kinetic characterization of D-xylose isomerases by enzymatic assays using D-sorbitol dehydrogenase. Enz. Microb. Technol. 9 (1987) 145-148). Aktywność in vitro izomerazy ksylozowej w wolnych od komórek ekstraktach transformowanych szczepów Cerevisiae zależy od dwuwartościowych kationów (Mg2+ lub Co2+). [0100] Aktywności kinazy ksylulozowej i reduktazy ksylozowej oznaczano jak opisano w Witteveen i wsp. (28). Jedną jednostkę aktywności definiowano jako ilość enzymu wytwarzającą 1 nmol ksylulozy na min w warunkach oznaczenia. Utworzoną ksylulozę określano sposobem według Dische i Borenfreund (Dische i Borenfreund, 1951, J. Biol. Chem. 192: 583-587) lub za pomocą HPLC przy użyciu kolumny Biorad HPX-87N w temp. 80°C i z elucją 0,6 ml/min przy użyciu 0,01 M Na2HPO4 jako eluentu. Ksyloza i ksyluloza były wykrywane za pomocą detektora z współczynnikiem załamania światła, przy temperaturze wewnętrznej 60°C. [0101] Swoista aktywność jest wyrażana jako jednostki na mg białka. Białko określano za pomocą odczynnika białkowego Bio-Rad (Bio-Rad Laboratories, Richmond, CA, USA) przy użyciu bydlęcej ?-globuliny jako standardu. 2. Wyniki 2.1 Nadekspresja genów szlaku pentozofosforanowego (PPP) [0102] Poprzednio wykazano, że eksprymowanie grzybowej izomerazy ksylozowej w Saccharomyces cerevisiae to zasadniczo wystarczająco, by umożliwić beztlenowy wzrost tych drożdży na ksylozie jako jedynym źródle węgla pod warunkiem zastosowania wystarczającej presji selekcyjnej [2]. Wyselekcjonowany szczep jednak nadal nie spełniał wymogów przemysłowych (Tabela 1). [0103] Dla przeanalizowania możliwości występowania etapów ograniczających szybkość - 28 w metabolizmie fosforanu pentozy zdecydowano, by skonstruować szczep nadeksprymujący wszystkie enzymy wymagane do konwersji ksylozy do fruktozo-6-fosforanu i gliceraldehydo3-fosforanu. Nadeksprymowane enzymy to: izomeraza ksylozowa (XI), ksylulokinaza (XKS), izomeraza rybulozo-5-fosforanowa (R5PI), epimeraza rybulozo-5-fosforanowa (R5PE), transketolaza (TKT) i transaldolaza (TAL). Dodatkowo dokonywano delecji nieswoistej reduktazy aldozowej, kodowanej przez GRE3, która pośredniczy w niechcianym wytwarzaniu ksylitolu [18]. Jako że niektóre z substratów enzymów w PPP nie są komercyjnie dostępne, zdecydowano o sprawdzaniu nadekspresji raczej za pośrednictwem macierzy DNA niż pomiarów aktywności enzymu. Wyniki wyszczególnione w Tabeli 1 dodatkowo potwierdziły, że transkrypcja docelowych genów była z powodzeniem modyfikowana w szczepie RWB 212. Tabela 1. Poziomy mRNA strukturalnych genów kodujących ksylulokinazę i enzymy szlaku pentozofosforanowego, w referencyjnym szczepie S. cerevisiae CEN.PK113-7D i w modyfikowanym, eksprymującym izomerazę ksylozy szczepie S. cerevisiae RWB212. Oba szczepy hodowano w tlenowych hodowlach chemostatowych, z ograniczeniem glukozy (D = 0,10 godz.-1). Poziomy transkryptu poziomy określano za pomocą mikromacierzy Affymetrix GeneChip. Dane to średnia ? przeciętne odchylenie od średniej z analizy dla trzech niezależnych hodowli dla każdego szczepu. ACT1 (Ng i Abelson, 1980, Proc. Nat. Acad. Sci. USA. 77: 3912-3916) i PDA1 (Wenzel i wsp., 1995, Nucleic. Acids Res. 23: 883884) uwzględniono jako wewnętrzne standardy. Gen Nazwa systematyczna Nazwa enzymu Poziom transkryptu Krotność zmiany CEN.PK113- RBW212 Mutant vs. 7D WT Xy1A - izomeraza ksylozowa n.d. n.d. XKS1 YGR194C Ksylulokinaza 91 ? 7 321 ? 54 + 3,5 TAL1 YLR354C Transaldolaza 574 ? 49 959 ? 91 + 1,7 TKL1 YPR074C transketolaza 1 450 ? 37 1982 79 RPE1 YJL121C 3-epimeraza fosforanowa RKI1 YOR095C D-rybulozo-5- 299 ? 24 2551 ? ? + 4,4 + 8,5 385 ketolo-izomeraza D-rybozo-5- 96 ? 8 fosforanowa 483 ? 64 + 5,0 CEN.PK113- RBW212 Mutant vs. 7D WT GRE3 YHR104w reduktaza aldozowa 322 ? 6 12 ? 0 ACT1 YFL039C Aktyna 408 ? 32 366 ? 56 NCa -26,8 - 29 - PDA1 YER178W podjednostka E1? kompleksu 2901 ? 142 dehydrogenazy pirogronianowej 3217 ? NC 182 n.d. = nie określono (brak przedstawienia na mikromacierzach Affymetrix); a NC= bez zmian. 2.2 Charakteryzacja fizjologiczna modyfikowanego szczepu [0104] Jedną z uderzających właściwości modyfikowanego szczepu była jego zdolność do wzrostu beztlenowego na ksylozie (Fig. 1) bez konieczności stosowania jakiejkolwiek presji selekcyjnej. Beztlenowy wzrost na ksylozie w mineralnej pożywce zachodził z szybkością wzrostu tak wysoką jak 0,09 h-1. Ksyluloza nie była akumulowana, jednak wykrywano tworzenie się ksylitolu, chociaż na skrajnie małym poziomie (Fig. 1); wydajności biomasy, etanolu i glicerolu dla szczepu RWB 212 na ksylozie były porównywalne do tych dla RWB 202-AFX który uzyskano na drodze ewolucyjnego modyfikowania (Tabela 2). Na podstawie Tabeli 2 można obliczyć swoistą szybkość zużywania ksylozy rzędu więcej niż 1,0 g ksylozy/g biomasy/godz. (Qs= 0,09/0,085 = 1,059 gr Xyl/gr X/godz.), w porównaniu do 345 mg ksylozy/g biomasy/godz. dla RWB 202-AFX podczas gdy uzyskiwano wydajność co najmniej podobną do wydajności na glukozie. 2.3. Wykorzystywanie mieszanych substratów [0105] Jak zaznaczono we wprowadzeniu: opłacalna konwersja hydrolizatów hemicelulozy do etanolu wymaga fermentacji zarówno glukozy, jak i ksylozy, korzystnie równocześnie. Dla zweryfikowania właściwości szczepu RWB 212 w odniesieniu do wykorzystywania mieszanych cukrów, drożdże hodowano w mieszaninie glukozy i ksylozy (20 g l -1 każdej). Wyniki przedstawione na Fig. 2 pokazują, że oba cukry zostały zużyte w całości, ale glukoza była korzystnym substratem. Zużywanie ksylozy rozpoczynało się po zużyciu w przybliżeniu 80% glukozy. 3. Funkcjonalna ekspresja izomerazy ksylozowej z B. thetaiotaomicron w drożdżach [0106] Sekwencję nukleotydową kodującą izomerazę ksylozową z B. thetaiotaomicron VPI5482 (numery akcesyjne AAO75900 lub NP 809706; SEQ ID NO. 10) klonowano do wielokopijnego drożdżowego wektora ekspresyjnego, uzyskując p426GPDBtXI. Ten plazmid stosowano do transformowania RWB215 (MAT? ura3-52 leu2-112 loxP-PTPI:: (-266,1)TAL1 gre3::hphMX pUGPTPI-TKL1 pUGPTPI-RPE1 KanloxP-PTPI::(-?,-1)RKI1), który był dalej transformowany p415ADHXKS dla celów prowadzenia nadekspresji ksylulokinazy. Wybrano dwa niezależne transformanty, i oba były zdolne do wzrostu na pożywce minimalnej z ksylozą jako jedynym źródłem węgla, a w lizatach transformantów mierzono swoistą aktywność izomerazy ksylozowej rzędu 140 +/- 20 U na mg białka, w porównaniu do około 1300 U na mg białka dla szczepów eksprymujących izomerazę ksylozową z Piromyces. - 30 - Tabela 3: startery stosowane w tym badaniu Nazwa oligo PTALdisA CCTTTCCAACGAATCGTATATACTAACATGCGCGCGCTTCCTATGCATA GGCCACTAGTGGATCTG PTALdisB AGAGAGTTGTTAGCAACCTTTTGTTTCTTTTGAGCTGGTTCAGACATGG TGAATTCCTGTATGTG 5?TAL1 CTGACTGAGCCATATTGAGG TAL1 intern CACCAGTGTCGGCAACAACG PRKIdisA TCTTGTAGAAAATTAACAACATCGTGTTACATAAACTTGGTTACGCATA GGCCACTAGTGGATCTG PRKIdisB TTGCCCAAAGATTCTAACGCATCAATTTTTGGGACACCGGCAGCCATG GTGAATTCCTGTATGTG RKI1 intern CAGCTCTCTTGGCATCCTCC EcoRI5?TKL1 GGAATTCATGACTCAATTCACTGACATTG 3?TKI1XhoI GGCCTCGAGCTTGAATGGTGTGATTGTCT TKL1 intern CCGCCATTGGTGATGTACAG EcoRI5?RPEI GGAATTCATGGTCAAACCAATTATAGC 3?RPEIXhoI CCGCTCGAGTTAGGCACTTACGTATCTTG RPE1 intern GGAAGCCTTATGGAGTGTCA PTPI1 starter TGGCATGTGAGATTCTCCGA KanA CGCACGTCAAGACTGTCAAG KanB TCGTATGTGAATGCTGGTCG 5?gre3::Ka AAAATACTGTAATATAAATCGTAAAGGAAAATTGGAAATTTTTTCAGC nlox TGAAGCTTCGTACGC 3?gre3::Ka TGGATTTTACTGGCTGGATCAGGCAAAAGTGGGGAATTTACCGCATAG - 31 - nlox GCCACTAGTGGATCTG 5?GRE3 CCTGGTGGAACATCCTAGAA 3?GRE3 GGATGACACCACAGGCAGAA SpeI5?XKS1 GACTAGTATGTTGTGTTCAGTAATTCAG 3?XKS1- TGCAGTCGACATTTTAGATGAGAGTCTTTTCC Sa1I Tabela 4: plazmidy stosowane w tej publikacji pUG6 kaseta loxP-KanMX-loxP Guldener i wsp. [3] pUG6PTPI1 z promotorem TPI1 ta publikacja pUG6PTPI1-RPE1 pUG6 z RPE1 za promotorem TPI1 ta publikacja PUG6PTPI1-TKL1 pUG6 z TKL1 za promotorem TPI1 ta publikacja pAG32 kaseta loxP-hphMX-loxP Goldstein i McCusker [9] PAKX002 2?, URA3, Piromyces XylA za promotorem TPI1 Kuyper i wsp. [20] P415ADH CEN, LEU2, promotor ADH1 Mumberg i wsp. [21] p415ADHXKS1 CEN, LEU2, PADH1-XKS1 ta publikacja PSH47 CEN, URA3, rekombinazy Cre za PGAL1 Guldener i wsp. [3] Piśmiennictwo [0107] 1. Bruinenberg, P. M., De Bot, P. H. M, Van Dijken, J. P. and Scheffers, W. A. (1983) The role of the redox balance in the anaerobic fermentation of xylose by yeasts. Eur. J. Appl. Microbiol. Biotechnol. 18, 287-292. 2. Kuyper, M., Winkler, A. A., Van Dijken; J. P. and Pronk, J. T. (2004) Minimal metabolic engineering of Saccharomyces cerevisiae for efficient anaerobic xylose fermentation: a proof of principle. FEMS Yeast Res. 4, 655-664. 3. Guldener, U., Heck, S., Fiedler, T., Beinhauer, J. and Hegemann, J. H. (1996) A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Res. 24, 2519-2524. 4. Mumberg, D., Muller, R. and Funk, M. (1995) Yeast Vvectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene 156,119122. 5. Sambrook, K.., Fritsch, E. F.. and Maniatis, I. (1989) Molecular cloning: A laboratory manual, 2nd edn., Cold spring harbour, New York. 6. Verduyn, C., Postma, E., Scheffers, W. A. and Van Dijken, J. P. (1992) Effect of - 32 - benzoic acid on metabolic fluxes in yeasts: a continuous-culture study on the regulation of respiration and alcoholic fermentation. Yeast 8, 501-517. 7. Gietz, R. D. and Woods, R. A. (2002) Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method. Methods Enzymol. 350,87-96. 8. Inoue, H., Nojima, H. and Okayama, H. (1990) High efficiency transformation of Escherichia coli with plasmids. Gene 96, 23-28. 9. Goldstein, A. L. and McCusker, J. H. (1999) Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast 15, 1541-1553. 10. Andreasen, A. A. and Stier, T. J. (1953) Anaerobic nutrition of Saccharomyces cenevisiae. I. Ergosterol requirement for growth in a defined medium. J. Cell Physiol. 41, 23-36. 11. Andreasen, A. A. and Stier, T. J. (1954) Anaerobic nutrition of Saccharomyces cerevisiae. II. Unsaturated fatty acid requirement for growth in a defined medium. J. Cell Physiol. 43, 271-281. 12. Van Urk, H., Mak, P. R., Scheffers, W. A. and Van Dijken, J. P. (1988) Metabolic responses of Saccharomyces cerevisiae CBS 8066 and Candida utilis CBS 621 upon transition from glucose limitation to glucose excess. Yeast 4, 283-291. 13. Weusthuis, R. A., Luttik, M. A., Scheffers, W. A., Van Dijken, J. P. and Pronk, J. T. (1994) Is the Kluyver effect in yeasts caused by product inhibition? Microbiology 140, 1723-1729. 14. Verduyn, C., Postma, E., Scheffers, W. A. and Van Dijken, J. P. (1990) Physiology of Saccharomyces cerevisiae in anaerobic glucose-limited chemostat cultures. J. Gen. Microbiol. 136, 395-403. 15. Piper, M. D., Daran-Lapujade, P., Bro, C., Regenberg, B., Knudsen, S., Nielsen, J. and Pronk, J. T. (2002) Reproducibility of oligonucleotide microarray transcriptome analyses. An interlaboratory comparison using chemostat cultures of Saccharomyces cerevisiae. J. Biol. Chem. 277, 37001-37008. 16. Boer, V. M., de Winde, J. H., Pronk, J. T. and Piper, M. D. (2003) The genomewide transcriptional responses of Saccharomyces cerevisiae grown on glucose in aerobic chemostat cultures limited for carbon, nitrogen, phosphorus, or sulfur. J. Biol. Chem. 278, 3265-3274. 17. Tusher, V. G., Tibshirani, R. and Chu, G. (2001) Significance analysis of microarrays applied to the ionizing radiation response. Proc. Natl. Acad. Sci. U. S. A 98,5116-5121. 18. Träff, K. L., Otero Cordero, R. R., Van Zyl, W. H. and Hahri-Hägerdal, B. (2001) Deletion of the GRE3 aldose reductase gene and its influence on xylose metabolism in recombinant strains of Saccharomyces cerevisiae expressing the xylA and XKS1 - 33 - genes. Appl. Environ. Microbiol. 67, 5668-5674. 19. Jeffries, T. W. and Jin, Y. S. (2004) Metabolic engineering for improved fermentation of pentoses by yeasts. Applied Microbiology and Biotechnology 63, 495509. 20. Kuyper, M., Harhangi, H. R., Stave, A. K., Winkler, A. A., Jetten, M. S., De Laat, W. T., D Ridder, J. J., Op den Camp, H. J., Van Dijken, J. P. and Pronk, J. T. (2003) High-level functional expression of a fungal xylose isomerase: the key to efficient ethanolic fermentation of xylose by Saccharomyces cerevisiae? FEMS Yeast Res. 4, 69-78. 21. Mumberg, D., Muller, R. and Funk, M. (1995) Yeast Vvectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene 156,119122. LISTA SEKWENCJI [0108] <110> Technische Universiteit Delft <120> Metaboliczne eukariotycznych modyfikowanie <130> P214817EP <140> P214817EP <141> 2004-07-07 <160> 18 <170> PatentIn wersja 3.1 <210> 1 <211> 437 <212> PRT <213> Piromyces sp. <220> <221> misc_feature <223> izomeraza ksylozowa <400> 1 fermentujących ksylozę komórek - 34 - - 35 - - 36 - <210> 2 <211> 438 <212> PRT <213> Bacteroides thetaiotamicron <220> <221> misc_feature <223> izomeraza ksylozowa <400> 2 - 37 - - 38 - <210> 3 <211> 600 <212> PRT <213> Saccharomyces cerevisiae <220> <221> misc_feature - 39 - <223> ksylulokinaza <400> 3 - 40 - - 41 - <210> 4 <211> 258 <212> PRT <213> Saccharomyces cerevisiae <220> <221> misc_feature <223> izomeraza rybulozo-5-fosforanowa <400> 4 - 42 - - 43 - <210> 5 <211> 238 <212> PRT <213> Saccharomyces cerevisiae <220> <221> misc_feature <223> epimeraza rybulozo-5-fosforanowa <400> 5 - 44 - <210> 6 <211> 680 <212> PRT <213> Saccharomyces cerevisiae <220> <221> misc_feature <223> transketolaza <400> 6 - 45 - - 46 - - 47 - <210> 7 <211> 335 <212> PRT <213> Saccharomyces cerevisiae <220> <221> misc_feature <223> transaldolaza <400> 7 - 48 - - 49 - <210> 8 <211> 327 <212> PRT <213> Saccharomyces cerevisiae <220> <221> misc_feature <223> reduktaza aldozowa <400> 8 - 50 - <210> 9 - 51 - <211> 1669 <212> DNA <213> Piromyces sp. <220> <221> misc_feature <223> izomeraza ksylozowa <400> 9 - 52 - <210> 10 <211> 1317 <212> DNA <213> Bacteroides thetaiotamicron <220> <221> misc_feature <223> izomeraza ksylozowa <400> 10 - 53 - - 54 - <210> 11 <211> 2467 <212> DNA <213> Saccharomyces cerevisiae <220> <221> misc_feature <223> ksylulokinaza <400> 11 - 55 - - 56 - <210> 12 <211> 777 <212> DNA <213> Saccharomyces cerevisiae <220> <221> misc_feature <223> izomeraza rybulozo-5-fosforanowa <400> 12 - 57 - <210> 13 <211> 1328 <212> DNA <213> Saccharomyces cerevisiae <220> <221> misc_feature <223> epimeraza rybulozo-5-fosforanowa <400> 13 - 58 - - 59 - <210> 14 <211> 2046 <212> DNA <213> Saccharomyces cerevisiae <220> <221> misc_feature <223> transketolaza <400> 14 - 60 - ttctaa 2046 - 61 - <210> 15 <211> 1008 <212> DNA <213> Saccharomyces cerevisiae <220> <221> misc_feature <223> transaldolaza <400> 15 - 62 - <210> 16 <211> 984 <212> DNA <213> Saccharomyces cerevisiae <220> <221> misc_feature <223> reduktaza aldozowa <400> 16 - 63 - <210> 17 <211> 494 <212> PRT <213> Piromyces sp. <220> <221> misc_feature <223> kinaza ksylulozowa <400> 17 - 64 - - 65 - <210> 18 <211> 2041 <212> DNA <213> Piromyces sp. <220> <221> misc_feature <223> kinaza ksylulozowa - 66 - <400> 18 - 67 - Piotr Godlewski Rzecznik patentowy - 68 Zastrzeżenia patentowe 1. Komórka gospodarza drożdży lub grzyba nitkowatego, transformowana konstruktem kwasu nukleinowego zawierającym sekwencję nukleotydową kodującą izomerazę ksylozową, która to izomeraza ksylozowa obejmuje sekwencję aminokwasową, która ma co najmniej 95% identyczności sekwencji względem sekwencji aminokwasowej z SEQ ID NO: 2, przy czym konstrukt kwasu nukleinowego, po transformacji komórki gospodarza, nadaje komórce gospodarza zdolność bezpośredniej izomeryzacji ksylozy do ksylulozy, przy czym komórka gospodarza obejmuje modyfikację genetyczną, która zwiększa strumień szlaku pentozofosforanowego, i przy czym modyfikacja genetyczna obejmuje nadekspresję co najmniej jednego genu z nieoksydacyjnej części szlaku pentozofosforanowego, w porównaniu z komórką gospodarza, która jest genetycznie identyczna za wyjątkiem modyfikacji genetycznej. 2. Komórka gospodarza według zastrzeżenia 1, przy czym sekwencja nukleotydowa koduje izomerazę ksylozowa, do uzyskania z bakterii z klasy Bacteroides. 3. Komórka gospodarza według zastrzeżenia 1 lub 2, przy czym gen z nieoksydacyjnej części szlaku pentozofosforanowego jest wybrany z grupy składającej się z genów kodujących izomerazę rybulozo-5-fosforanową, epimerazę rybulozo-5-fosforanową, transketolazę i transaldolazę. 4. Komórka gospodarza według zastrzeżenia 3, przy czym modyfikacja genetyczna obejmuje nadekspresję co najmniej genów kodujących transketolazę i transaldolazę. 5. Komórka gospodarza według dowolnego z zastrzeżeń 1-4, przy czym komórka gospodarza obejmuje ponadto modyfikację genetyczną, która zwiększa swoistą aktywność kinazy ksylulozowej. 6. Komórka gospodarza według zastrzeżenia 5, przy czym modyfikacja genetyczna obejmuje nadekspresję genu kodującego kinazę ksylulozową, która jest nadeksprymowana. 7. Komórka gospodarza według dowolnego z zastrzeżeń 1-6, przy czym gen, który jest nadeksprymowany jest endogenny dla komórki gospodarza. 8. Komórka gospodarza według dowolnego z zastrzeżeń 1-7, przy czym komórka gospodarza obejmuje modyfikację genetyczną, która zmniejsza nieswoistą aktywność reduktazy aldozowej w komórce gospodarza. 9. Komórka gospodarza według zastrzeżenia 8, przy czym modyfikacja genetyczna zmniejsza ekspresję, lub inaktywuje gen kodujący nieswoistą reduktazę aldozową. 10. Komórka gospodarza według zastrzeżenia 9, przy czym gen jest inaktywowany przez delecję co najmniej części genu lub przerwanie ciągłości genu. 11. Komórka gospodarza według zastrzeżeń 8 lub 9, przy czym ekspresja każdego genu w komórce gospodarza, który koduje nieswoistą reduktazę aldozową jest zmniejszona lub inaktywowana. - 69 - 12. Komórka gospodarza według dowolnego z poprzednich zastrzeżeń, przy czym komórka gospodarza oznacza drożdże, korzystnie drożdże, które należą do jednego z rodzajów: Saccharomyces, Kluyveromyces, Candida, Pichia, Schizosaccharomyces, Hansenula, Kloeckera, Schwanniomyces i Yarrowia. 13. Komórka gospodarza według zastrzeżenia 12, przy czym drożdże należą do jednego z gatunków: S. cerevisiae, S. bulderi, S. barnetti, S. exiguus, S. uvarum, S. diastaticus, K lactis, K marxianus, i K. fragilis. 14. Komórka gospodarza według dowolnego z zastrzeżeń 1-11, przy czym komórka gospodarza oznacza grzyba nitkowatego, korzystnie grzyba nitkowatego, który należy do jednego z rodzajów: Aspergillus, Trichoderma, Humicola, Acremonium, Fusarium i Penicillium. 15. Komórka gospodarza według dowolnego z poprzednich zastrzeżeń, przy czym komórka gospodarza eksprymuje jeden lub większą liczbę enzymów, które nadają komórce gospodarza zdolność do wytwarzania co najmniej jednego produktu fermentacji wybranego z grupy składającej się z etanolu, kwasu mlekowego, kwasu 3hydroksypropionowego, kwasu akrylowego, kwasu octowego, kwasu bursztynowego, kwasu cytrynowego, aminokwasów, 1,3-propanodiolu, etylenu, glicerolu, antybiotyków ?-laktamowych i cefalosporyn. 16. Sposób do wytwarzania etanolu, przy czym sposób obejmuje etapy: (a) fermentowania pożywki zawierającej źródło ksylozy z udziałem modyfikowanej komórki gospodarza jak zdefiniowano w dowolnym z zastrzeżeń 1-14, przy czym komórka gospodarza fermentuje ksylozę do etanolu, i opcjonalnie, (b) odzyskiwania etanolu. 17. Sposób według zastrzeżenia 16, przy czym pożywka zawiera również źródło glukozy. 18. Sposób według zastrzeżeń 16 lub 17, przy czym objętościowa wydajność etanolu wynosi co najmniej 0,5 g etanolu na litr na godzinę. 19. Sposób według dowolnego z zastrzeżeń 16-18, przy czym wydajność etanolu wynosi co najmniej 50%. 20. Sposób do wytwarzania produktu fermentacji wybranego z grupy składającej się z kwasu mlekowego, kwasu 3-hydroksypropionowego, kwasu akrylowego, kwasu octowego, kwasu bursztynowego, kwasu cytrynowego, aminokwasów, 1,3propanodiolu, etylenu, glicerolu, antybiotyków ?-laktamowych i cefalosporyn, przy czym sposób obejmuje etapy: (a) fermentowania pożywki zawierającej źródło ksylozy z udziałem modyfikowanej komórki gospodarza jak zdefiniowano w zastrzeżeniu 15, przy czym komórka gospodarza fermentuje ksylozę do produktu fermentacji, i opcjonalnie, (b) odzyskiwania produktu fermentacji. - 70 - 21. Sposób według zastrzeżenia 20, przy czym pożywka zawiera również źródło glukozy. Piotr Godlewski Rzecznik patentowy - 71 - - 72 -








































































Grupy dyskusyjne