Money.plTechnologie dla biznesuPrzemysłPatentyEP 2018426 T3
Wyszukiwarka patentów
  • od
  • do
Patent EP 2018426 T3


EP 2018426 T3

RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2018426 (96) Data i numer zgłoszenia patentu europejskiego: 17.05.2007 07797553.0 (97) O udzieleniu patentu europejskiego ogłoszono: 15.05.2013 Europejski Biuletyn Patentowy 2013/20 EP 2018426 B1 (13) (51) T3 Int.Cl. C12N 15/113 (2010.01) A61K 31/713 (2006.01) A61P 27/02 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (54) Tytuł wynalazku: HAMOWANIE Z UDZIAŁEM RNAI STANÓW ZWIĄZANYCH Z CZYNNIKIEM MARTWICY GUZÓW ALFA (30) Pierwszeństwo: 19.05.2006 US 801788 P Zgłoszenie ogłoszono: 28.01.2009 w Europejskim Biuletynie Patentowym nr 2009/05 (43) (45) O złożeniu tłumaczenia patentu ogłoszono: 31.10.2013 Wiadomości Urzędu Patentowego 2013/10 (73) Uprawniony z patentu: Alcon Research, Ltd., Fort Worth, US (72) Twórca(y) wynalazku: JOHN M. YANNI, Burleson, US JON E. CHATTERTON, Crowley, US DIANE MICHELLE SENCHYNA, Fort Worth, US DANIEL A. GAMACHE, Arlington, US STEVEN T. MILLER, Arlington, US PL/EP 2018426 T3 (74) Pełnomocnik: rzecz. pat. Hanna Dreszer-Lichańska DRESZER GRENDA i WSPÓLNICY SP.J. KANCELARIA PATENTOWO-PRAWNA Al. Niepodległości 188 B III p. 00-608 Warszawa Uwaga: W ciągu dziewięciu miesięcy od publikacji informacji o udzieleniu patentu europejskiego, każda osoba może wnieść do Europejskiego Urzędu Patentowego sprzeciw dotyczący udzielonego patentu europejskiego. Sprzeciw wnosi się w formie uzasadnionego na piśmie oświadczenia. Uważa się go za wniesiony dopiero z chwilą wniesienia opłaty za sprzeciw (Art. 99 (1) Konwencji o udzielaniu patentów europejskich). 1 EP 2 018 426 B1 HAMOWANIE Z UDZIAŁEM RNAI STANÓW ZWIĄZANYCH Z CZYNNIKIEM MARTWICY GUZÓW ALFA 5 DZIEDZINA WYNALAZKU [0001] Przedmiotowy wynalazek dotyczy dziedziny kompozycji interferującego RNA do wyciszania czynnika martwicy guzów ? (TNF? ? ang. tumor necrosis factor ?) przez wyciszenie mRNA receptora 1 TNF powierzchni komórki TNF? (TNFR1) lub mRNA enzymu konwertującego TNF? (TACE/ADAM17). Wyciszanie takich celów TNF? jest pożyteczne do leczenia pacjentów, u których występuje stan związany z TNF? lub ryzyko rozwinięcia takiego stanu. TŁO WYNALAZKU 10 15 20 25 30 35 40 45 [0002] Zapalenie jest na ogół leczone za pomocą standardowej procedury przeciwzapalnej, która obejmuje steroidy i/lub niesteroidalne leki przeciwzapalne (NSAIDS ? ang. nonsteroidal anti-inflammatory drugs). Alergiczne zapalenie spojówek, zapalenie oka, zapalenie skóry, zapalenie nosa i astma były historycznie leczone procedurą ustnych, donosowych lub miejscowych antyhistamin oprócz doustnych lub donosowych steroidów. Leczenie ogólnoustrojowe typowo wymaga podawania wyższych stężeń związku będącego lekiem, by uzyskać skuteczne stężenie, które osiągnie konieczne miejsce leczenia. Wiadomo, że związki antyhistaminowe mają aktywność w ośrodkowym układzie nerwowym; senność i suchość błon śluzowych są częstym efektem ubocznym stosowania antyhistamin. Steroidy i NSAIDS mają potencjalne efekty uboczne obejmujące wewnątrzoczne zwiększenie ciśnienia, zaćmę, jaskrę lub topienie rogówki. [0003] Suche oko, znane także jako conjunctivitis sicca lub keratoconjunctivitis sicca, jest częstym zaburzeniem oftalmologicznym obejmującym rozkład błony łez przed okiem, co powoduje wysuszenie eksponowanej zewnętrznej powierzchni oka. Dotychczas suche oko było leczone miejscowym podawaniem roztworów sztucznych łez. Niektóre z tych roztworów zawierają substancje mukomimetyczne, by przejściowo zastąpić lub uzupełnić warstwę mucyny u pacjentów z niedoborem mucyny. Zaproponowano zastosowanie metyloprednizolonu w krótkoterminowej terapii "pulsowej", by leczyć zaostrzenia suchego oka. Proponowana terapia ?pulsowa? jest wymagana, by uniknąć komplikacji związanych z tradycyjną terapią steroidową dla stanów zapalnych, takich jak zwiększone ciśnienie wewnątrz oka i tworzenie zaćmy. [0004] Cytokina TNF? jest celem terapii przeciwzapalnej suchego oka i zapalenia błony naczyniowej oka. W modelu króliczym suchego oka indukowanego zapaleniem gruczołów łzowych uzyskano hamowanie barwienia rogówki i przywrócenie czasu rozpadu łzy przez swoistą modulację poziomów powierzchniowych TNF? oka. Terapia suchego oka wynikała z hamowania syntezy TNF? (RDP58) lub swoistego zobojętniania TNF? z zastosowaniem przeciwciała monoklonalnego (REMICADE?) lub rozpuszczalnego receptora (ENBREL?). Każda z tych sterowanych TNF? terapii dała poziomy skuteczności otrzymywane z miejscowymi ocznymi steroidami przeciwzapalnymi. [0005] Publikacja Patentu U.S. 2005/0227935, opublikowana 13 października 2005, McSwiggen i in., dotyczy hamowania ekspresji genu TNF i receptora TNF z udziałem interferencji RNA. Jednak publikacja ta nie poucza o żadnej z poszczególnych docelowych 2 EP 2 018 426 B1 5 sekwencji dla interferencji RNA, jak tu podano. [0006] Lindstedt i in., 2005 (The British Journal of Ophthalmology 89(5):533-536) opisuje hamowanie TNF-alfa przez przeciwciała i zastosowanie takich przeciwciał do leczenia zapalenia oka. [0007] Wykonania przedmiotowego wynalazku odpowiadają występującej w tej dziedzinie potrzebie dalszej terapii suchego oka i zapalenia i dostarczają alternatywne terapie. STRESZCZENIE WYNALAZKU 10 15 20 25 30 35 40 45 [0008] Przedmiotowy wynalazek dostarcza silną i skuteczną terapię, zapobieganie lub interwencję dla stanu oka związanego z TNF? bez efektów ubocznych związanych ze steroidami lub NSAIDS, gdzie ten stan oka związany z TNF? jest suchym okiem, alergicznym zapaleniem spojówek lub zapaleniem oka. W jednym aspekcie wynalazek obejmuje leczenie osobnika, u którego występuje stan oka związany z TNF? lub ryzyko rozwinięcia stanu oka związanego z TNF? przez podanie interferujących RNA, które wyciszają ekspresję mRNA TACE lub mRNA TNFR1, tym samym interferując odpowiednio z proteolityczną obróbką prekursora do TNFa lub z wiązaniem TNF? do jego receptora na powierzchni komórki, w ten sposób atenuując aktywność TNF? i zapobiegając kaskadzie zdarzeń związanych z apoptozą i zapaleniem, gdzie ten stan oka związany z TNF? jest suchym okiem, alergicznym zapaleniem spojówek lub zapaleniem oka. [0009] Jak tu opisano, stan związany z TNF? obejmuje stany takie, jak suche oko i stany zapalne związane z TNF?. Jak tu dalej opisano, stan zapalny związany z TNF? obejmuje stany takie, jak na przykład zapalenie oka, alergiczne zapalenie spojówek, zapalenie skóry, zapalenie nosa i astma, i obejmuje takie zmiany komórkowe wynikające z aktywności TNF?, które prowadzą bezpośrednio lub pośrednio do stanu zapalnego związanego z TNF?. Stan zapalny związany z TNF? w szczególności obejmuje związane z TNF? stany oka takie, jak suche oko, alergiczne zapalenie spojówek i zapalenie oka. Opisany tu interferujący RNA zapewnia wyciszanie celów TNF? mRNA TACE lub mRNA TNFR1, zarazem unikając niepożądanych efektów ubocznych związanych z niespecyficznymi czynnikami. [0010] Opisano tu metodę atenuacji ekspresji mRNA TACE osobnika. Metoda obejmuje podanie osobnikowi kompozycji obejmującej skuteczną ilość interferującego RNA mającego długość 19 do 49 nukleotydów i farmaceutycznie dopuszczalny nośnik, przy czym interferujący RNA obejmuje region przynajmniej 13 kolejnych nukleotydów mających przynajmniej 90% komplementarności sekwencji do lub przynajmniej 90% identyczności sekwencji z przedostatnimi 13 nukleotydami końca 3' mRNA odpowiadającego dowolnej z SEK NR ID: 3, SEK NR ID:14 - SEK NR ID:58 i SEK NR ID:155-SEK NR ID:201. W ten sposób ulega atenuacji ekspresja mRNA TACE. [0011] Opisano tu także leczenie stanu związanego z TNF? u potrzebującego tego osobnika, obejmujące podanie osobnikowi kompozycji zawierającej skuteczną ilość interferującego RNA mającego długość 19 do 49 nukleotydów i farmaceutycznie dopuszczalny nośnik, gdzie interferujący RNA obejmuje region przynajmniej 13 kolejnych nukleotydów mających przynajmniej 90% komplementarności sekwencji do lub przynajmniej 90% identyczności sekwencji z 13 przedostatnimi nukleotydami końca 3' mRNA odpowiadającymi dowolnej z SEK NR ID: 3, SEK NR ID:14 - SEK NR ID:58 i SEK NR ID:155-SEK NR ID:201. W ten sposób jest leczony stan związany z TNF?. [0012] Ponadto opisano tu metodę atenuacji aktywności TNF? u osobnika przez atenuację ekspresji mRNA TACE lub mRNA TNFR1 u osobnika, obejmująca podanie osobnikowi kompozycji zawierającej skuteczną ilość interferującego RNA mającego długość 19 do 49 nukleotydów i farmaceutycznie dopuszczalny nośnik, a interferujący RNA zawiera sensowną 3 EP 2 018 426 B1 5 10 15 20 25 30 35 40 45 50 nić nukleotydową, antysensowną nić nukleotydową i region przynajmniej niemal doskonałej kolejnej komplementarności przynajmniej 19 nukleotydów, gdzie nić antysensowna hybrydyzuje w warunkach fizjologicznych do części mRNA odpowiadającej SEK NR ID:1 obejmującej nukleotyd 297, 333, 334, 335, 434, 470, 493, 547, 570, 573, 618, 649, 689, 755, 842, 844, 846, 860, 878, 894, 900, 909, 910, 913, 942, 970, 984, 1002, 1010, 1053, 1064, 1137, 1162, 1215, 1330, 1334, 1340, 1386, 1393, 1428, 1505, 1508, 1541, 1553, 1557, 1591, 1592, 1593, 1597, 1604, 1605, 1626, 1632, 1658, 1661, 1691, 1794, 1856, 1945, 1946, 1947, 1958, 2022, 2094, 2100, 2121, 2263, 2277, 2347, 2349, 2549, 2578, 2595, 2606, 2608, 2629, 2639, 2764, 2766, 2767, 2769, 3027, 3028, 3261, 3264, 3284, 3313, 3317, 3332 lub 3337, gdzie antysensowna nić hybrydyzuje w warunkach fizjologicznych do części mRNA odpowiadającej SEK NR ID:2, poczynając od nukleotydu 124, 328, 387, 391, 393, 395, 406, 421, 423, 444, 447, 455, 459, 460, 467, 469, 470, 471, 475, 479, 513, 517, 531, 543, 556, 576, 587, 588, 589, 595, 601, 602, 611, 612, 651, 664, 667, 668, 669, 677, 678, 785, 786, 788, 791, 792, 804, 813, 824, 838, 843, 877, 884, 929, 959, 960, 961, 963, 964, 965, 970, 973, 974, 1000, 1002, 1013, 1026, 1053, 1056, 1057, 1058, 1161, 1315, 1318, 1324, 1357, 1360, 1383, 1393, 1420, 1471, 1573, 1671, 2044, 2045, 2046, 2047, 2048, 2089, 2090, 2091, 2092 lub 2098. Ekspresja mRNA TACE jest atenuowana, gdy antysensowna nić hybrydyzuje do części mRNA odpowiadającej SEK NR ID:1, jak podano powyżej. Ekspresja mRNA TNFR1 jest atenuowana, gdy antysensowna nić hybrydyzuje do części mRNA odpowiadającej SEK NR ID:2, jak podano powyżej. [0013] Ponadto opisano tu leczenie stanu związanego z TNF? u potrzebującego tego osobnika, obejmujące podanie osobnikowi kompozycji obejmującej skuteczną ilość interferującego RNA mającego długość 19 do 49 nukleotydów i farmaceutycznie dopuszczalny nośnik, przy czym interferujący RNA obejmuje sensowną nić nukleotydów, antysensowną nić nukleotydów i region przynajmniej niemal doskonałej kolejnej komplementarności przynajmniej 19 nukleotydów; gdzie antysensowna nić hybrydyzuje w warunkach fizjologicznych do części mRNA odpowiadającej SEK NR ID:1 obejmującej nukleotyd 297, 333, 334, 335, 434, 470, 493, 547, 570, 573, 618, 649, 689, 755, 842, 844, 846, 860, 878, 894, 900, 909, 910, 913, 942, 970, 984, 1002, 1010, 1053, 1064, 1137, 1162, 1215, 1330, 1334, 1340, 1386, 1393, 1428, 1505, 1508, 1541, 1553, 1557, 1591, 1592, 1593, 1597, 1604, 1605, 1626, 1632, 1658, 1661, 1691, 1794, 1856, 1945, 1946, 1947, 1958, 2022, 2094, 2100, 2121, 2263, 2277, 2347, 2349, 2549, 2578, 2595, 2606, 2608, 2629, 2639, 2764, 2766, 2767, 2769, 3027, 3028, 3261, 3264, 3284, 3313, 3317, 3332 lub 3337. W ten sposób jest leczony stan związany z TNF?. [0014] Dalej opisano tu leczenie stanu oczu związanego z TNF? u potrzebującego tego osobnika, obejmujące podanie osobnikowi kompozycji zawierającej skuteczną ilość interferującego RNA mającego długość 19 do 49 nukleotydów i farmaceutycznie dopuszczalny nośnik, przy czym interferujący RNA zawiera sensowną nić nukleotydów, antysensowną nić nukleotydów i region przynajmniej niemal doskonałej kolejnej komplementarności przynajmniej 19 nukleotydów; gdzie antysensowna nić hybrydyzuje w warunkach fizjologicznych do części mRNA odpowiadającej SEK NR ID:2 obejmującej nukleotyd 124, 328, 387, 391, 393, 395, 406, 421, 423, 444, 447, 455, 459, 460, 467, 469, 470, 471, 475, 479, 513, 517, 531, 543, 556, 576, 587, 588, 589, 595, 601, 602, 611, 612, 651, 664, 667, 668, 669, 677, 678, 785, 786, 788, 791, 792, 804, 813, 824, 838, 843, 877, 884, 929, 959, 960, 961, 963, 964, 965, 970, 973, 974, 1000, 1002, 1013, 1026, 1053, 1056, 1057, 1058, 1161, 1315, 1318, 1324, 1357, 1360, 1383, 1393, 1420, 1471, 1573, 1671, 2044, 2045, 2046, 2047, 2048, 2089, 2090, 2091, 2092 lub 2098. W ten sposób jest leczony stan związany z TNF?. [0015] Drugi interferujący RNA mający długość 19 do 49 nukleotydów mógł także być podany osobnikowi w kolejnym wykonaniu; drugi interferujący RNA zawiera sensowną nić 4 EP 2 018 426 B1 5 10 15 20 25 30 35 40 45 50 nukleotydów, antysensowną nić nukleotydów i region przynajmniej niemal doskonałej komplementarności przynajmniej 19 nukleotydów, gdzie antysensowna nić drugiego interferującego RNA hybrydyzuje w warunkach fizjologicznych do części mRNA odpowiadającej SEK NR ID:1 obejmującej nukleotyd, jak podano powyżej, lub gdzie antysensowna nić hybrydyzuje w warunkach fizjologicznych do części mRNA odpowiadającej SEK NR ID:2, począwszy od nukleotydu 124, 328, 387, 391, 393, 395, 406, 421, 423, 444, 447, 455, 459, 460, 467, 469, 470, 471, 475, 479, 513, 517, 531, 543, 556, 576, 587, 588, 589, 595, 601, 602, 611, 612, 651, 664, 667, 668, 669, 677, 678, 785, 786, 788, 791, 792, 804, 813, 824, 838, 843, 877, 884, 929, 959, 960, 961, 963, 964, 965, 970, 973, 974, 1000, 1002, 1013, 1026, 1053, 1056, 1057, 1058, 1161, 1315, 1318, 1324, 1357, 1360, 1383, 1393, 1420, 1471, 1573, 1671, 2044, 2045, 2046, 2047, 2048, 2089, 2090, 2091, 2092 lub 2098. [0016] Gdy pierwszy interferujący RNA adresuje SEK NR ID:1, drugi interferujący RNA może adresować SEK NR ID:1 lub SEK NR ID:2, i na odwrót, gdy pierwszy interferujący RNA adresuje SEK NR ID:2, drugi interferujący RNA może adresować SEK NR ID:1 lub SEK NR ID:2. Jak dalej tu opisano, może być podany trzeci, czwarty lub więcej interferujących RNA. [0017] Opisano tu także leczenie stanu związanego z TNF? u potrzebującego tego osobnika, obejmujące podanie osobnikowi kompozycji obejmującej dwuniciową cząsteczkę siRNA, która obniża ekspresję genu TACE przez interferencję RNA, gdzie każda nić cząsteczki siRNA ma niezależnie około 19 do około 27 nukleotydów długości; i jedna nić cząsteczki siRNA obejmuje sekwencję nukleotydów mających znaczną komplementarność do mRNA odpowiadającego genowi TACE, tak, że cząsteczka siRNA steruje cięciem mRNA przez interferencję RNA. [0018] Opisano tu także leczenie stanu oczu związanego z TNF? u potrzebującego tego osobnika, obejmujące podanie osobnikowi kompozycji zawierającej dwuniciową cząsteczkę siRNA, która obniża ekspresję genu TNFR1 przez interferencję RNA, gdzie każda nić cząsteczki siRNA ma niezależnie około 19 do około 27 nukleotydów długości; i jedna nić cząsteczki siRNA obejmuje sekwencję nukleotydów mających znaczną komplementarność do mRNA odpowiadającego genowi TNFR1 tak, że cząsteczka siRNA steruje cięciem mRNA przez interferencję RNA. [0019] Ponadto opisano tu metodę atenuacji ekspresji mRNA TACE u osobnika, obejmująca podanie osobnikowi kompozycji zawierającej skuteczną ilość jednoniciowego interferującego RNA i farmaceutycznie dopuszczalny nośnik. Jednoniciowy interferujący RNA ma długość 19 do 49 nukleotydów i hybrydyzuje w warunkach fizjologicznych do części mRNA odpowiadającej SEK NR ID:1 obejmującej nukleotyd 297, 333, 334, 335, 434, 470, 493, 547, 570, 573, 618, 649, 689, 755, 842, 844, 846, 860, 878, 894, 900, 909, 910, 913, 942, 970, 984, 1002, 1010, 1053, 1064, 1137, 1162, 1215, 1330, 1334, 1340, 1386, 1393, 1428, 1505, 1508, 1541, 1553, 1557, 1591, 1592, 1593, 1597, 1604, 1605, 1626, 1632, 1658, 1661, 1691, 1794, 1856, 1945, 1946, 1947, 1958, 2022, 2094, 2100, 2121, 2263, 2277, 2347, 2349, 2549, 2578, 2595, 2606, 2608, 2629, 2639, 2764, 2766, 2767, 2769, 3027, 3028, 3261, 3264, 3284, 3313, 3317, 3332 lub 3337, i interferujący RNA ma region przynajmniej niemal doskonałej kolejnej komplementarności do hybrydyzującej części mRNA odpowiadającej SEK NR ID:1. W ten sposób ulega atenuacji ekspresja mRNA TACE. [0020] Ponadto opisano tu kompozycję zawierającą interferujący RNA mający długość 19 do 49 nukleotydów, i obejmującą sekwencję nukleotydów odpowiadającą dowolnej z SEK NR ID:3, SEK NR ID:14 - SEK NR ID:58 i SEK NR ID:155-SEK NR ID:201 lub jej dopełnieniu; i farmaceutycznie dopuszczalny nośnik. [0021] Jest tu także opisana kompozycja zawierająca interferujący RNA złożony zasadniczo z sekwencji nukleotydów odpowiadającej dowolnej z SEK NR ID:59 - SEK NR ID:69, SEK 5 EP 2 018 426 B1 5 NR ID:71 - SEK NR ID:92 i SEK NR ID:94 - SEK NR ID:154 lub jej dopełnieniu; i farmaceutycznie dopuszczalny nośnik. [0022] Zastosowanie dowolnego z aspektów, jak tu opisano, w przygotowaniu leku do atenuacji ekspresji mRNA TACE lub mRNA TNFR1 jako metody atenuacji aktywności TNF? i w ten sposób leczenia stanu związanego z TNF?, jak tu opisano, też jest tu opisana. KRÓTKI OPIS FIGUR [0023] Aby przedstawić sposób, w którym uzyskuje się wymienione powyżej i inne zalety i cele wynalazku, będzie podany bardziej szczegółowy opis wynalazku pokrótce opisanego powyżej przez odniesienie do konkretnych jego wykonań, które są zilustrowane na załączonych rysunkach. Rozumiejąc, że te rysunki tylko przedstawiają typowe wykonania wynalazku i nie należy ich traktować jako ograniczające jego zakres, wynalazek będzie opisany z dodatkowymi szczegółami przez odniesienie do załączonych rysunków, w których: [0024] Na FIG. 1 przedstawiono western blot TNFR1 komórek GTM-3 transfekowanych siRNA TNFR1 #1, #2, #3 i #4 i wolny od RISC kontrolny siRNA, każdy 10 nM, 1 nM i 0,1 nM; nieadresowany kontrolny siRNA (NTC2) 10 nM; i kontrolę z buforem (-siRNA). Strzałki wskazują pozycje prążków 55-kDa TNFR1 i 42-kDa aktyny. SZCZEGÓŁOWY OPIS WYNALAZKU [0025] Przedmiotowy wynalazek jest określony w zastrzeżeniach. [0026] Następujące definicje i wyjaśnienia powinny być uważane za wytyczne dla dowolnej przyszłej konstrukcji, o ile nie są wyraźnie i jednoznacznie modyfikowane w następujących przykładach lub gdy stosowanie znaczenia czyni dowolną konstrukcję bez znaczenia lub zasadniczo bez znaczenia. W przypadkach, gdy konstrukcja określenia czyniłaby je bez znaczenia lub zasadniczo bez znaczenia, definicja powinna być zaczerpnięta z Webster's Dictionary, 3rd Edition. [0027] Jak tu użyto, wszystkie procenty są procentami wagowo, o ile nie wskazano inaczej. [0028] Jak tu użyto i o ile nie wskazano inaczej, określenia pojedyncze oznaczają "jeden", "przynajmniej jeden" lub "jeden lub więcej". [0029] Określenie "suche oko," także znane jako conjunctivitis sicca lub keratoconjunctivitis sicca, jest częstym zaburzeniem oftalmologicznym obejmującym rozpad błony łez przed okiem, skutkując odwodnieniem eksponowanej zewnętrznej powierzchni oka. [0030] Określenie "zapalenie oka," jak tu użyto, obejmuje na przykład zapalenie tęczówki, zapalenie błony naczyniowej oka, zapalenie nadtwardówki, zapalenie twardówki, zapalenie rogówki, wewnętrzne zapalenie oka, zapalenie powiek i jatrogenne stany zapalne. [0031] Określenie "alergiczne zapalenie spojówek," jak tu użyto, odnosi się do zapalenia spojówki, która jest delikatną błoną, która wyściela powieki i przykrywa eksponowaną powierzchnię twardówki. Określenie "alergiczne zapalenie spojówek" obejmuje, na przykład, atopowe zapalenie rogówki i spojówki, ogromne brodawkowate zapalenie spojówek, zapalenie spojówek w katarze siennym, trwałe alergiczne zapalenie spojówek i wiosenne zapalenie rogówki i spojówki. [0032] Określenie "region przynajmniej 13 kolejnych nukleotydów mających przynajmniej 90% komplementarności sekwencji do lub przynajmniej 90% identyczności sekwencji do przedostatnich 13 nukleotydów końca 3' mRNA odpowiadającego dowolnej z (identyfikator sekwencji)" pozwala na jedno podstawienie nukleotydu. Dwa podstawienia nukleotydu (tzn. 11/13 = 85% identyczności/komplementarności) nie są objęte w takim określeniu. 10 15 20 25 30 35 40 45 6 EP 2 018 426 B1 5 [0033] Określenie "procent identyczności" opisuje procent kolejnych nukleotydów w pierwszej cząsteczce kwasu nukleinowego, która jest taka sama jak w zestawie kolejnych nukleotydów tej samej długości w drugiej cząsteczce kwasu nukleinowego. Określenie "procent komplementarności" opisuje procent kolejnych nukleotydów w pierwszej cząsteczce kwasu nukleinowego, która może tworzyć pary zasad w znaczeniu Watson-Crick z zestawem kolejnych nukleotydów w drugiej cząsteczce kwasu nukleinowego. [0034] Jak tu użyto, określenie "hybrydyzacja" oznacza i dotyczy procesu, w którym jednoniciowe kwasy nukleinowe z komplementarnymi lub prawie komplementarnymi sekwencjami zasad interagują, by wytworzyć połączone wiązaniami wodorowymi kompleksy nazywane hybrydami. Reakcje hybrydyzacji są czułe i selektywne. In vitro, swoistość hybrydyzacji (tzn. ostrość) jest kontrolowana na przykład przez stężenia soli lub formamidu w roztworach do prehybrydyzacji i hybrydyzacji i przez temperaturę hybrydyzacji; takie procedury są dobrze znane w dziedzinie. W szczególności ostrość jest zwiększona przez obniżenie stężenia soli, zwiększenie stężenia formamidu lub podwyższenie temperatury hybrydyzacji. [0035] Na przykład, warunki wysokiej ostrości mogłyby wystąpić przy około 50% formamidu w 37 °C do 42 °C. Warunki obniżonej ostrości mogłyby wystąpić przy około 35% do 25% formamidu w 30 °C do 35 °C. Przykłady warunków ostrości hybrydyzacji są podane w Sambrook, J., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Dalsze przykłady ostrych warunków hybrydyzacji obejmują 400 mM NaCl, 40 mM PIPES pH 6,4, 1 mM EDTA, 50 °C lub 70 °C przez 12-16 godzin, po czym następuje płukanie, lub hybrydyzację w 70 °C w 1XSSC lub 50 °C w 1XSSC, 50% formamidu, po czym następuje płukanie w 70 °C w 0,3XSSC, lub hybrydyzację w 70 °C w 4XSSC lub 50 °C w 4XSSC, 50% formamidu, po czym następuje płukanie w 67 °C w 1XSSC. Temperatura hybrydyzacji jest około 5-10 °C niższa od temperatury topnienia (Tm) hybrydy, gdzie Tm jest określany dla hybryd pomiędzy 19 i 49 par zasad długości przy zastosowaniu następującego wyliczenia: Tm °C = 81,5 + 16,6(log10[Na+]) + 0,41 (% G+C) - (600/N), gdzie N jest liczbą zasad w hybrydzie i [Na+] jest stężeniem jonów sodu w buforze do hybrydyzacji. [0036] Cytowane tu sekwencje kwasów nukleinowych są pisane w kierunku 5' do 3', o ile nie wskazano inaczej. Określenie "kwas nukleinowy", jak tu użyto, odnosi się do DNA lub RNA, lub jego modyfikowanej postaci zawierającej zasady purynowe lub pirymidynowe obecne w DNA (adenina "A", cytozyna "C", guanina "G", tymina "T") lub w RNA (adenina "A", cytozyna "C", guanina "G", uracyl "U"). Interferujące RNA tu przewidziane mogą zawierać zasady "T", szczególnie na końcach 3', chociaż zasady "T" nie występują naturalnie w RNA. "Kwas nukleinowy" obejmuje określenia "oligonukleotyd" i "polinukleotyd" i może odnosić się do jednoniciowej cząsteczki lub dwuniciowej cząsteczki. Dwuniciowa cząsteczka jest tworzona przez parowanie zasad Watson-Crick pomiędzy zasadami A i T, zasadami C i G, i pomiędzy zasadami A i U. Nici dwuniciowej cząsteczki mogą mieć częściową, zasadniczą lub pełną komplementarność do siebie nawzajem i wytworzą hybrydę w formie dupleksu, której siła wiązania zależy od charakteru i stopnia komplementarności sekwencji zasad. [0037] Sekwencja mRNA może być łatwo wydedukowana z sekwencji odpowiadającej sekwencji DNA. Na przykład, SEK NR ID:1 dostarcza sekwencję nici sensownej DNA odpowiadającej mRNA dla TACE. Sekwencja mRNA jest identyczna do sekwencji sensownej nici DNA z zasadami "T" zastąpionymi przez zasady "U". Tak więc sekwencja mRNA TACE jest znana z SEK NR ID:1 i mRNA TNFR1 jest znane z SEK NR ID:2. [0038] Interferencja RNA (RNAi) jest procesem, za pomocą którego dwuniciowy RNA (dsRNA) jest stosowany do wyciszania ekspresji genów. Nie chcąc być związanym teorią, RNAi rozpoczyna się od cięcia dłuższych dsRNA na małe interferujące RNA (siRNA) przez 10 15 20 25 30 35 40 45 50 7 EP 2 018 426 B1 5 10 15 20 25 30 35 40 45 50 enzym podobny do RNazyIII, dicer. SiRNA są dsRNA, które mają zazwyczaj około 19 do 28 nukleotydów lub 20 do 25 nukleotydów, lub 21 do 22 nukleotydów długości i często zawierają przedłużenia 2 nukleotydów na 3' i końce 5' fosforanowe i 3' hydroksylowe. Jedna nić siRNA jest włączana do kompleksu rybonukleoproteinowego znanego jako indukowany przez RNA kompleks wyciszający (RISC ? ang. RNA-induced silencing complex). RISC stosuje tę nić siRNA do identyfikacji cząsteczek mRNA, które są przynajmniej częściowo komplementarne do włączonej nici siRNA, i następnie tnie te docelowe mRNA lub hamuje ich translację. Tak więc nić siRNA, która jest włączona do RISC, jest znana jako nić prowadząca lub nić antysensowna. Druga nić siRNA, znana jako nić pasażerska lub nić sensowna, jest eliminowana z siRNA i jest przynajmniej częściowo homologiczna do docelowego mRNA. Osoby biegłe w dziedzinie rozpoznają, że w zasadzie dowolna nić siRNA może być włączona do RISC i działać jako nić prowadząca. Jednak projektowanie siRNA (np. zmniejszona stabilność dupleksu siRNA na końcu 5' pożądanej nici prowadzącej) może sprzyjać inkorporacji pożądanej nici prowadzącej do RISC. [0039] Cięcie z udziałem RISC mRNA mających sekwencję przynajmniej częściowo komplementarną do nici prowadzącej prowadzi do obniżenia w poziomie równowagi tego mRNA i odpowiedniego białka kodowanego przez ten mRNA. Alternatywnie, RISC może także zmniejszyć ekspresję odpowiedniego białka przez represję translacji bez cięcia docelowego mRNA. Inne cząsteczki RNA i cząsteczki podobne do RNA mogą także oddziaływać z RISC i wyciszać ekspresję genów. Przykłady innych cząsteczek RNA, które mogą oddziaływać z RISC, obejmują krótkie RNA typu szpilka do włosów (shRNA ? ang. short hairpin RNA), jednoniciowe siRNA, mikroRNA (miRNA) i 27-merowe dupleksy dicersubstrat. Określenie "siRNA", jak tu użyto, odnosi się do dwuniciowego interferującego RNA, o ile nie podano inaczej. Przykłady cząsteczek podobnych do RNA, które mogą oddziaływać z RISC, obejmują cząsteczki RNA zawierające jeden lub więcej chemicznie modyfikowany nukleotyd, jeden lub więcej deoksyrybonukleotyd i/lub jedno lub więcej wiązań niefosfodiestrowych. Dla celów niniejszego omówienia, wszystkie cząsteczki RNA lub podobne do RNA, które mogą oddziaływać z RISC i biorą udział w zmianach ekspresji genów z udziałem RISC, będą określane jako "interferujące RNA". SiRNA, shRNA, miRNA i 27-merowe dupleksy dicer-substrat są więc podzbiorami "interferujących RNA". [0040] Interferujące RNA wykonań wynalazku wydają się działać w sposób katalityczny do cięcia docelowego mRNA, tzn. interferujący RNA jest zdolny do przeprowadzania hamowania docelowego mRNA w ilościach substechiometrycznych. W porównaniu do terapii antysensownych, wymagane jest znacząco mniej interferującego RNA, by dać efekt terapeutyczny w takich warunkach cięcia. [0041] Przedmiotowy wynalazek dotyczy stosowania interferującego RNA do hamowania ekspresji receptora 1 TNF powierzchni komórki TNF? (TNFR1) lub enzymu konwertującego TNF? (TACE/ADAM17, określanego tu jako "TACE"), których hamowanie obniża aktywność czynnika martwicy guzów ? (TNF?). Wiązanie TNF? do jego receptora powierzchni komórki, receptora-1 TNF (TNFR1), aktywuje kaskadę sygnalizacyjną, która wpływa na różne odpowiedzi komórkowe obejmujące apoptozę i zapalenie. Sam TNF? jest początkowo wyrażany jako nieaktywny prekursor związany z błoną. Uwalnianie aktywnej formy TNF? z powierzchni komórki wymaga proteolitycznej obróbki prekursora przez enzym konwertujący TNF? (TACE/ADAM17), członka rodziny 'A Disintegrin And Metalloprotease' (ADAM) (dezintegryny i metaloproteazy). [0042] Według przedmiotowego wynalazku, hamowanie ekspresji mRNA TNFR1, mRNA TACE lub zarówno mRNA TNFR1, jak i TACE, skutecznie zmniejsza działanie TNF?. Ponadto, interferujące RNA, jak tu przedstawiono, dostarczone egzogennie lub wyrażane endogennie, są szczególnie skuteczne w wyciszaniu mRNA TNFR1 lub mRNA TACE. [0043] mRNA enzymu konwertującego czynnik martwicy guzów ? (TACE/ADAM17): Baza 8 EP 2 018 426 B1 5 10 15 20 25 30 35 40 45 50 danych GenBank dostarcza sekwencję DNA dla TACE jako numer dostępu NM_003183, zawarty w ?Liście Sekwencji? jako SEK NR ID:1. SEK NR ID:1 dostarcza sekwencję nici sensownej DNA, która odpowiada mRNA kodującemu TACE (z wyjątkiem zasad "T" za zasady "U"). Sekwencją kodującą TACE są nukleotydy 184 - 2658. [0044] Równoważniki cytowanej powyżej sekwencji mRNA TACE są alternatywnymi wariantami składania, formami allelicznymi, izozymami lub ich odpowiednikiem. Odpowiednikiem jest mRNA enzymu konwertującego czynnik martwicy guzów ? z innego gatunku ssaka, który jest homologiczny do SEK NR ID:1 (tzn. ortolog). [0045] mRNA receptora 1 czynnika martwicy guzów (TNFR1): Baza danych GenBank dostarcza sekwencję DNA dla TNFR1 jako numer dostępu NM_001065, zawarty w ?Liście Sekwencji? jako SEK NR ID:2. SEK NR ID:2 dostarcza sekwencję nici sensownej DNA, która odpowiada mRNA kodującemu TNFR1 (z wyjątkiem zasad "T" za zasady "U"). Sekwencją kodującą dla TNFR1 są nukleotydy 282 - 1649. [0046] Równoważnikami podanej powyżej sekwencji mRNA TNFR1 są alternatywne formy składania, formy alleliczne, izozymy lub ich odpowiedniki. Odpowiednikiem jest mRNA receptora-1 czynnika martwicy guzów z innego gatunku ssaka, który jest homologiczny do SEK NR ID:2 (tzn. ortolog). [0047] Atenuacja ekspresji mRNA: Określenie "atenuacja ekspresji mRNA," jak tu użyto, oznacza podanie lub ekspresję ilości interferującego RNA (np. siRNA) do obniżenia translacji docelowego mRNA do białka, przez cięcie mRNA lub przez bezpośrednie hamowanie translacji. Zmniejszenie ekspresji docelowego mRNA lub odpowiadającego mu białka jest powszechnie określane jako "knock-down" i jest podawane względem poziomów obecnych po podaniu lub ekspresji nieadresującego kontrolnego RNA (np. nieadresującego kontrolnego siRNA). Knock-down ekspresji w ilości obejmującej pomiędzy 50% i 100% jest uwzględniany przez przedstawione tu wykonania. Jednak nie jest konieczne uzyskanie takich poziomów knock-down dla celów przedmiotowego wynalazku. W jednym wykonaniu podawany jest pojedynczy interferujący RNA adresujący mRNA TACE lub mRNA TNFR1. W innych wykonaniach podane są dwa lub więcej interferujące RNA adresujące mRNA TACE lub mRNA TNFR1. W dalszych wykonaniach podawane są interferujące RNA adresujące każdy z mRNA TACE i mRNA TNFR1, w kombinacji lub w odstępie czasu tak, by miały zachodzące na siebie efekty. [0048] Knock-down jest powszechnie oceniany przez pomiar poziomów mRNA przy zastosowaniu amplifikacji z ilościową reakcją łańcuchową polimerazy (qPCR ? ang. quantitative polymerase chain reaction) lub przez pomiar poziomów białka za pomocą western blot lub oznaczenia immunosorpcyjnego związanego z enzymem (ELISA ? ang. enzyme-linked immunosorbent assay). Analiza poziomu białka umożliwia ocenę zarówno cięcia mRNA, jak i hamowania translacji. Dalsze techniki pomiaru knock-down obejmują hybrydyzację RNA w roztworze, ochronę przed nukleazami, hybrydyzację typu northern, monitorowanie ekspresji genów za pomocą mikromacierzy, wiązanie przeciwciał, radioimmunooznaczenie i analizę komórek aktywowaną przez fluorescencję. [0049] Hamowanie TACE lub TNFR1 może też być oznaczone in vitro przez ocenę poziomów docelowego mRNA lub poziomów docelowego białka, na przykład, w komórkach nabłonka ludzkiej rogówki po transfekcji interferującego RNA na TACE lub TNFR1, jak opisano poniżej. [0050 Hamowanie aktywności TNF? przez hamowanie ekspresji mRNA TACE lub ekspresji mRNA TNFR1 jest też dedukowane u człowieka lub ssaka przez obserwację poprawy w objawie stanu związanego z TNF?, takiej jak poprawa objawów związanych z suchym okiem, alergicznym zapaleniem spojówek, zapaleniem oka, zapaleniem skóry, zapaleniem nosa lub astmą. Poprawa w jakimkolwiek z objawów suchego oka, na przykład obrzęku, swędzeniu, zapaleniu lub tolerancji na wyzwania środowiskowe, jest wskazaniem hamowania aktywności 9 EP 2 018 426 B1 5 10 15 20 25 30 35 TNF?. [0051] Interferujący RNA: W jednym wykonaniu wynalazku interferujący RNA (np. siRNA) ma nić sensowną i nić antysensowną, i nić sensowna i antysensowna zawierają region przynajmniej niemal doskonałej kolejnej komplementarności przynajmniej 19 nukleotydów. W innym wykonaniu wynalazku interferujący RNA (np. siRNA) ma nić sensowną i nić antysensowną, i nić antysensowna zawiera region przynajmniej niemal doskonałej kolejnej komplementarności przynajmniej 19 nukleotydów do docelowej sekwencji mRNA TACE lub mRNA TNFR1, i nić sensowna zawiera region przynajmniej niemal doskonałej kolejnej identyczności przynajmniej 19 nukleotydów odpowiednio do docelowej sekwencji mRNA TACE lub mRNA TNFR1. W kolejnym wykonaniu wynalazku interferujący RNA zawiera region przynajmniej 13, 14, 15, 16, 17 lub 18 kolejnych nukleotydów mających procenty komplementarności sekwencji do lub mających procenty identyczności sekwencji z przedostatnimi odpowiednio 13, 14, 15, 16, 17 lub 18 nukleotydami końca 3' odpowiedniej sekwencji docelowej w obrębie mRNA. [0052] Długość każdej nici interferującego RNA obejmuje 19 do 49 nukleotydów i może obejmować długość 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48 lub 49 nukleotydów. [0053] Antysensowna nić siRNA jest aktywnym czynnikiem naprowadzającym siRNA przez to, że nić antysensowna jest włączana do RISC, w ten sposób pozwalając RISC na identyfikację docelowych mRNA z przynajmniej częściową komplementarnością do antysensownej nici siRNA do cięcia lub represji translacyjnej. [0054] Także tu opisane sekwencje docelowe interferującego RNA (np. sekwencje docelowe siRNA) w obrębie docelowej sekwencji mRNA są wybierane przy zastosowaniu dostępnych narzędzi do projektowania. Interferujące RNA odpowiadające docelowej sekwencji TACE lub TNFR1 są następnie testowane przez transfekcję komórek wyrażających docelowe mRNA, po czym następuje ocena knockdown, jak opisano powyżej. [0055] Techniki selekcji docelowych sekwencji dla siRNA są podane przez Tuschl, T. i in., "The siRNA User Guide", poprawiony 6 maja 2004, dostępny w witrynie internetowej Rockefeller University; przez Technical Bulletin #506, "siRNA Design Guidelines", Ambion Inc. w witrynie internetowej Ambion; i przez inne oparte na sieci narzędzia do projektowania w, na przykład, witrynach internetowych Invitrogen, Dharmacon, Integrated DNA Technologies, Genscript lub Proligo. Wyjściowe parametry przeszukiwania mogą obejmować zawartości G/C pomiędzy 35% i 55% i długości siRNA pomiędzy 19 i 27 nukleotydów. Docelowa sekwencja może być zlokalizowana w kodującym regionie lub w regionach 5' lub 3' nie ulegających translacji mRNA. [0056] Wykonanie 19-nukleotydowej docelowej sekwencji DNA dla mRNA TACE jest obecne przy nukleotydach 297 do 315 SEK NR ID: 1: 5'- GCTCTCAGACTACGATATT -3' SEK NR ID:3. 40 siRNA według wynalazku do adresowania odpowiedniej sekwencji mRNA SEK NR ID:3 i mający 21-nukleotydowe nici i przedłużenie 2-nukleotydowe na 3' to: 45 5'- GCUCUCAGACUACGAUAUUNN -3' SEK NR ID:4 3' -NNCGAGAGUCUGAUGCUAUAA -5' SEK NR ID:5. Każda reszta "N" może być dowolnym nukleotydem (A, C, G, U, T) lub modyfikowanym nukleotydem. Koniec 3' może mieć liczbę "N" reszt pomiędzy i obejmującą 1, 2, 3, 4, 5 i 6. Reszty "N" na każdej nici mogą być tą samą resztą (np. UU, AA, CC, GG lub TT) lub mogą być różne (np. AC, AG, AU, CA, CG, CU, GA, GC, GU, UA, UC lub UG). Przedłużenia 3' 50 10 EP 2 018 426 B1 mogą być takie same lub mogą być różne. W jednym wykonaniu obie nici mają przedłużenie 3'UU. [0057] siRNA według wynalazku do adresowania odpowiedniej sekwencji mRNA SEK NR ID:3 i mający 21-nukleotydowe nici i przedłużenie 3'UU na każdej nici to: 5 5'- GCUCUCAGACUACGAUAUUUU -3' SEK NR ID:6 3'- UUCGAGAGUCUGAUGCUAUAA -5' SEK NR ID:7. 10 [0058] Interferujący RNA może też mieć przedłużenie 5' nukleotydów lub może mieć tępe końce. siRNA według wynalazku do adresowania odpowiedniej sekwencji mRNA SEK NR ID:3 i mający19-nukleotydowe nici i tępe końce to: 5'- GCUCUCAGACUACGAUAUU -3' SEK NR ID:8 3'- CGAGAGUCUGAUGCUAUAA -5' SEK NR ID:9. 15 [0059] Nici dwuniciowego interferującego RNA (np. siRNA) mogą być połączone dla wytworzenia struktury typu szpilka do włosów lub łodyżka-pętla (np. shRNA). shRNA według wynalazku adresujący odpowiednią sekwencję mRNA SEK NR ID:3 i mający 19 bp dwuniciowy region łodyżki i przedłużenie 3'UU to: 20 25 30 35 N jest nukleotydem A, T, C, G, U lub modyfikowaną formą znaną osobie o przeciętnych umiejętnościach w dziedzinie. Liczba nukleotydów N w pętli jest liczbą pomiędzy i obejmującą 3 do 23 lub 5 do 15, lub 7 do 13, lub 4 do 9, lub 9 do 11, lub liczba nukleotydów N jest 9. Niektóre z nukleotydów w pętli mogą brać udział w interakcjach par zasad z innymi nukleotydami w pętli. Przykłady sekwencji oligonukleotydów, które mogą być stosowane do wytworzenia pętli, obejmują 5'-UUCAAGAGA-3' (Brummelkamp, T.R. i in. (2002) Science 296: 550) i 5'-UUUGUGUAG-3' (Castanotto, D. i in. (2002) RNA 8:1454). Osoba biegła w dziedzinie rozpozna, że powstający jednoniciowy oligonukleotyd tworzy strukturę typu łodyżka-pętla lub szpilka do włosów zawierającą dwuniciowy region zdolny do interakcji z maszynerią RNAi. [0060] Docelowa sekwencja siRNA zidentyfikowana powyżej może być wydłużona na końcu 3', by ułatwić projektowanie 27-merowych dupleksów dicer-substrat. Wydłużenie 19nukleotydowej docelowej sekwencji DNA (SEK NR ID:3) zidentyfikowanej w sekwencji DNA TACE (SEK NR ID:1) przez 6 nukleotydów daje 25-nukleotydową docelową sekwencję DNA obecną przy nukleotydach 297 do 321, SEK NR ID:1: 5'- GCTCTCAGACTACGATATTCTCTCT -3' SEK NR ID:11. 40 27-merowy dupleks dicer-substrat według wynalazku do adresowania odpowiedniej sekwencji mRNA SEK NR ID:11 to: 11 EP 2 018 426 B1 5'- GCUCUCAGACUACGAUAWCUCUCU -3' SEK NR ID:12 3' -UUCGAGAGUCUGAUGCUAUAAGAGAGA -5' SEK NR ID:13. 5 10 15 Dwa nukleotydy na końcu 3' nici sensownej (tzn. nukleotydy CU SEK NR ID:12) mogą być deoksynukleotydami dla wzmożonej obróbki. Projektowanie 27-merowych dupleksów dicersubstrat z 19-21 nukleotydowych sekwencji docelowych, takich jak tu przewidziano, jest dalej omówione w witrynie internetowej Integrated DNA Technologies (IDT) i przez Kim, D.-H. i in., (Luty 2005) Nature Biotechnology 23:2; 222-226. [0061] Gdy interferujące RNA są produkowane za pomocą syntezy chemicznej, fosforylacja na pozycji 5' nukleotydu na końcu 5' jednej lub obu nici (gdy jest obecna) może wzmagać skuteczność siRNA i swoistość związanego kompleksu RISC, ale nie jest wymagana, ponieważ fosforylacja może zachodzić wewnątrzkomórkowo. [0062] Tabela 1 wylicza przykłady docelowych sekwencji DNA TACE SEK NR ID:1, z których zaprojektowano siRNA według wynalazku w sposób, jak podano powyżej. TACE koduje enzym konwertujący czynnik martwicy guza ?, jak podano powyżej. Tabela 1. Docelowe sekwencje TACE dla siRNA Sekwencja Docelowa TACE # początkowego nukleotydu w odniesieniu do SEK NR ID:1 GCTCTCAGACTACGATATT 297 CCAGCAGCATTCGGTAAGA 333 CAGCAGCATTCGGTAAGAA 334 AGCAGCATTCGGTAAGAAA 335 AGAGATCTACAGACTTCAA 355 GAAAGCGAGTACACTGTAA 493 CCATGAAGAACACGTGTAA 842 GAAGAACACGTGTAAATTA 846 ATCATCGCTTCTACAGATA 878 AGAGCAATTTAGCTTTGAT 1137 GGTTTGACGAGCACAAAGA 1330 TGATCCGGATGGTCTAGCA 1428 GCGATCACGAGAACAATAA 1508 GCAGTAAACAATCAATCTA 1541 CAATCTATAAGACCATTGA 1553 TTTCAAGAACGCAGCAATA 1591 TTCAAGAACGCAGCAATAA 1592 TCAAGAACGCAGCAATAAA 1593 TCATGTATCTGAACAACGA 1661 ACAGCGACTGCACGTTGAA 1691 GATTAATGCTACTTGCAAA 1794 CTGGAGTCCTGTGCATGTA 1945 TGGAGTCCTGTGCATGTAA 1946 GGAGTCCTGTGCATGTAAT 1947 CATGTAATGAAACTGACAA 1958 CTATGTCGATGCTGAACAA 2022 CAAATGTGAGAAACGAGTA 2100 GCATCGGTTCGCATTATCA 2347 SEK NR ID: 3 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 12 EP 2 018 426 B1 ATCGGTTCGCATTATCAAA CCAAGTCATTTGAGGATCT CCGGTCACCAGAAGTGAAA AAAGGCTGCCTCCTTTAAA TTTAAACTGCAGCGTCAGA AGATGCTGGTCATGTGTTT ATGCTGGTCATGTGTTTGA TGCTGGTCATGTGTTTGAA CTGGTCATGTGTTTGAACT TGTAATGAACCGCTGAATA GTAATGAACCGCTGAATAT CTAAGACTAATGCTCTCTA AGACTAATGCTCTCTAGAA CCTAACCACCTACCTTACA TACATGGTAGCCAGTTGAA TGGTAGCCAGTTGAATTTA TTTATGGAATCTACCAACT GGAATCTACCAACTGTTTA CATCAAGTACTGAACGTTT TCGTGGTGGTGGATGGTAA GAAAGCGAGTACACTGTAA GAGCCTGACTCTAGGGTTC CCACATAAGAGATGATGAT CATAAGAGATGATGATGTT CGAATATAACATAGAGCCA GTTAATGATACCAAAGACA CTGAAGATATCAAGAATGT ATGAAGAGTTGCTCCCAAA ATGAAGAACACGTGTAAAT AATTATTGGTGGTAGCAGA ATCATCGCTTCTACAGATA ATACATGGGCAGAGGGGAA GGGCAGAGGGGAAGAGAGT GGAAGAGAGTACAACTACA GAAGAGAGTACAACTACAA GAGAGTACAACTACAAATT GCTAATTGACAGAGTTGAT CGGAACACTTCATGGGATA GGATAATGCAGGTTTTAAA AGGCTATGGAATACAGATA GAATACAGATAGAGCAGAT GGTAAAACCTGGTGAAAAG GTGAAAAGCACTACAACAT GAGGAAGCATCTAAAGTTT TATGGGAACTCTTGGATTA TGACGAGCACAAAGAATTA GCACAAAGAATTATGGTAA 2349 2549 2578 2595 2608 2764 2766 2767 2769 3027 3028 3261 3264 3284 3313 3317 3332 3337 434 470 493 547 570 573 618 649 689 755 844 860 878 894 900 909 910 913 942 970 984 1002 1010 1053 1064 1162 1215 1334 1340 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 13 EP 2 018 426 B1 GGTTACAACTCATGAATTG ACTCATGAATTGGGACATA GTGGCGATCACGAGAACAA CTATAAGACCATTGAAAGT GAACGCAGCAATAAAGTTT GCAATAAAGTTTGTGGGAA CAATAAAGTTTGTGGGAAC GAGGGTGGATGAAGGAGAA GGATGAAGGAGAAGAGTGT GCATCATGTATCTGAACAA CAGGAAATGCTGAAGATGA GAATGGCAAATGTGAGAAA GGATGTAATTGAACGATTT GTGGATAAGAAATTGGATA GGATAAACAGTATGAATCT CCTTTAAACTGCAGCGTCA CGTGTTGACAGCAAAGAAA GCAAAGAAACAGAGTGCTA 1386 1393 1505 1557 1597 1604 1605 1626 1632 1658 1856 2094 2121 2263 2277 2606 2629 2639 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 Tabela 2 wylicza przykłady sekwencji docelowych DNA TNFR1 SEK NR ID:2, z których zaprojektowano siRNA według wynalazku w sposób, jak podano powyżej. TNFR1 koduje receptor-1 czynnika martwicy guzów ?, jak podano powyżej. 5 Tabela 2. Docelowe sekwencje TNFR1 dla siRNA Sekwencja Docelowa TNFR1 # początkowego nukleotydu w odniesieniu do SEK NR ID:2 ACCAGGCCGTGATCTCTAT 124 AATTCGATTTGCTGTACCA 444 TCGATTTGCTGTACCAAGT 447 ACAAAGGAACCTACTTGTA 469 GAACCTACTTGTACAATGA 475 CTACTTGTACAATGACTGT 479 TGTGAGAGCGGCTCCTTCA 531 TCAGGTGGAGATCTCTTCT 611 CA6GTGGAGATCTCTTCTT 612 AGAACCAGTACCGGCATTA 667 GAACCAGTACCGGCATTAT 668 AACCAGTACCGGCATTATT 669 CCGGCATTATTGGAGTGAA 677 CGGCATTATTGGAGTGAAA 678 AGCCTGGAGTGCACGAAGT 843 CTCCTCTTCATTGGTTTAA 960 TTGGTTTAATGTATCGCTA 970 GTTTAATGTATCGCTACCA 973 TTTAATGTATCGCTACCAA 974 AGTCCAAGCTCTACTCCAT 1000 GAGCTTGAAGGAACTACTA 1053 SEK NR ID: 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 14 EP 2 018 426 B1 CTTGAAGGAACTACTACTA TTGAAGGAACTACTACTAA ACAAGCCACAGAGCCTAGA TGTACGCCGTGGTGGAGAA CCGTTGCGCTGGAAGGAAT TCTAAGGACCGTCCTGCGA CTAATAGAAACTTGGCACT TAATAGAAACTTGGCACTC AATAGAAACTTGGCACTCC ATAGAAACTTGGCACTCCT TAGAAACTTGGCACTCCTG ATAGCAAGCTGAACTGTCC TAGCAAGCTGAACTGTCCT AGCAAGCTGAACTGTCCTA GCAAGCTGAACTGTCCTAA TGAACTGTCCTAAGGCAGG CAAAGGAACCTACTTGTAC GAGCTTGAAGGAACTACTA CACAGAGCCTAGACACTGA TCCAAGCTCTACTCCATTG TGGAGCTGTTGGTGGGAAT GACAGGGAGAAGAGAGATA GGGAGAAGAGAGATAGTGT GAGAAGAGAGATAGTGTGT GAAGAGAGATAGTGTGTGT GTGTGTGTCCCCAAGGAAA GAAAATATATCCACCCTCA AAATATATCCACCCTCAAA CTGTACCAAGTGCCACAAA ACCAAGTGCCACAAAGGAA CCAAGTGCCACAAAGGAAC CCACAAAGGAACCTACTTG CAAAGGAACCTACTTGTAC AAAGGAACCTACTTGTACA GATACGGACTGCAGGGAGT CGGACTGCAGGGAGTGTGA TCCTTCACCGCTTCAGAAA CAGAAAACCACCTCAGACA TGCCTCAGCTGCTCCAAAT CTCCAAATGCCGAAAGGAA TCCAAATGCCGAAAGGAAA CCAAATGCCGAAAGGAAAT GCCGAAAGGAAATGGGTCA AGGAAATGGGTCAGGTGGA GGAAATGGGTCAGGTGGAG GTGTGTGGCTGCAGGAAGA GGAAGAACCAGTACCGGCA 1056 1057 1318 1357 1383 1671 2044 2045 2046 2047 2048 2089 2090 2091 2092 2098 470 1053 1324 1002 328 387 391 393 395 406 421 423 455 459 460 467 470 471 513 517 543 556 576 587 588 589 595 601 602 651 664 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 15 EP 2 018 426 B1 CCATGCAGGTTTCTTTCTA CATGCAGGTTTCTTTCTAA TGCAGGTTTCTTTCTAAGA AGGTTTCTTTCTAAGAGAA GGTTTCTTTCTAAGAGAAA AGAGAAAACGAGTGTGTCT GAGTGTGTCTCCTGTAGTA CTGTAGTAACTGTAAGAAA AGAAAAGCCTGGAGTGCAC TTGAGAATGTTAAGGGCAC TGTTAAGGGCACTGAGGAC GGTCATTTTCTTTGGTCTT CCTCCTCTTCATTGGTTTA TCCTCTTCATTGGTTTAAT CTCTTCATTGGTTTAATGT TCTTCATTGGTTTAATGTA CTTCATTGGTTTAATGTAT TCCAAGCTCTACTCCATTG CTCCATTGTTTGTGGGAAA GGGAAATCGACACCTGAAA TGAAGGAACTACTACTAAG ACCTCCAGCTCCACCTATA CCCACAAGCCACAGAGCCT ACGCCGTGGTGGAGAACGT GGAAGGAATTCGTGCGGCG TGAGCGACCACGAGATCGA GCGAGGCGCAATACAGCAT TGGGCTGCCTGGAGGACAT 785 786 788 791 792 804 813 824 838 877 884 929 959 961 963 964 965 1002 1013 1026 1058 1161 1315 1360 1393 1420 1471 1573 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 5 10 15 20 [0063] Jak podano w przykładach powyżej, osoba biegła w dziedzinie jest w stanie wykorzystać informację o docelowej sekwencji dostarczoną w Tabelach 1 lub 2 do zaprojektowania interferujących RNA mających długość krótszą lub dłuższą niż sekwencje podane w tabelach przez odniesienie się do pozycji sekwencji w SEK NR ID: 1 lub SEK NR ID:2 i dodanie lub deletowanie nukleotydów komplementarnych lub prawie komplementarnych odpowiednio do SEK NR ID:1 lub SEK NR ID:2. [0064] Reakcja cięcia docelowego RNA sterowana przez siRNA i inne formy interferującego RNA jest wysoce swoista względem sekwencji. Ogólnie, siRNA zawierający sensowną nić nukleotydów identyczną pod względem sekwencji do części docelowego mRNA i antysensowną nić nukleotydów dokładnie komplementarną do części docelowego mRNA są wykonaniami siRNA do hamowania podanych tu mRNA. Jednak 100% komplementarności sekwencji między antysensowną nicią siRNA i docelowym mRNA lub pomiędzy antysensowną nicią siRNA i sensowną nicią siRNA nie jest wymagana do praktykowania przedmiotowego wynalazku. Tak więc, na przykład, wynalazek pozwala na zmiany sekwencji, których można oczekiwać ze względu na mutacje genetyczne, polimorfizm szczepów lub dywergencję ewolucyjną. [0065] Jak tu opisano, nić antysensowna siRNA ma przynajmniej prawie doskonałą kolejną komplementarność przynajmniej 19 nukleotydów z docelowym mRNA. Określenie "niemal doskonała", jak tu użyto, oznacza, że nić antysensowna siRNA jest "zasadniczo 16 EP 2 018 426 B1 5 10 15 20 25 30 35 40 45 50 komplementarna do" i nić sensowna siRNA jest "zasadniczo identyczna" z przynajmniej częścią docelowego mRNA. "Identyczność", jak jest wiadome osobie o przeciętnych umiejętnościach w dziedzinie, jest stopniem pokrewieństwa sekwencji pomiędzy sekwencjami nukleotydów, jak zostało określone przez dopasowanie kolejności i tożsamości nukleotydów między sekwencjami. W jednym wykonaniu nić antysensowna siRNA mająca 80% i pomiędzy 80% do 100% komplementarności, na przykład 85%, 90% lub 95% komplementarności, do docelowej sekwencji mRNA jest uważana za niemal doskonale komplementarną i może być stosowana w przedmiotowym wynalazku. "Doskonała" kolejna komplementarność jest standardowym parowaniem Watson-Crick przyległych par zasad. "Przynajmniej niemal doskonała" kolejna komplementarność obejmuje "doskonałą" komplementarność, jak tu użyto. Metody komputerowe określenia identyczności lub komplementarności są zaprojektowane do identyfikacji największego stopnia pasujących sekwencji nukleotydów, na przykład BLASTN (Altschul, S.F., i in. (1990) J. Mol. Biol. 215:403-410). [0066] Stosunek między docelowym mRNA (nić sensowna) i jedną nicią siRNA (nić sensowna) jest stosunkiem identyczności. Nić sensowna siRNA jest też nazywana nicią pasażerską, o ile jest obecna. Stosunek między docelowym mRNA (nić sensowna) i drugą nicią siRNA (nić antysensowna) jest stosunkiem komplementarności. Nić antysensowna siRNA jest też nazywana nicią prowadzącą. [0067] Przedostatnia zasada w sekwencji kwasu nukleinowego, która jest pisana w kierunku 5' do 3', jest obok ostatniej zasady, tzn. jest zasadą obok zasady 3?. Przedostatnie 13 zasad sekwencji kwasu nukleinowego, która jest pisana w kierunku 5' do 3', to ostatnie 13 zasad sekwencji obok zasady 3', nie obejmujących zasady 3'. Podobnie przedostatnie 14, 15, 16, 17 lub 18 zasad sekwencji kwasu nukleinowego, która jest pisana w kierunku 5' do 3', to ostatnie 14, 15, 16, 17 lub 18 zasad sekwencji, odpowiednio, obok zasady 3', nie obejmujących zasady 3'. [0068] Jak tu opisano, region kolejnych nukleotydów jest regionem przynajmniej 13 kolejnych nukleotydów mających przynajmniej 90% komplementarności sekwencji do lub przynajmniej 90% identyczności sekwencji z przedostatnimi 13 nukleotydami końca 3' mRNA odpowiadającymi sekwencji identyfikowanej przez każdy identyfikator sekwencji. [0069] Jak tu opisano, region kolejnych nukleotydów jest regionem przynajmniej 14 kolejnych nukleotydów mających przynajmniej 85% komplementarności sekwencji do lub przynajmniej 85% identyczności sekwencji z przedostatnimi 14 nukleotydami końca 3' mRNA odpowiadającymi sekwencji identyfikowanej przez każdy identyfikator sekwencji. Dwa podstawienia nukleotydów (tzn. 12/14 = 86% identyczności/komplementarności) są objęte takim określeniem. [0070] Jak tu dalej opisano, region kolejnych nukleotydów jest regionem przynajmniej 15, 16, 17 lub 18 kolejnych nukleotydów mających przynajmniej 80% komplementarności sekwencji do lub przynajmniej 80% identyczności sekwencji z przedostatnimi 14 nukleotydami końca 3' mRNA odpowiadającymi sekwencji identyfikatora sekwencji. Trzy podstawienia nukleotydów są objęte takim określeniem. [0071] Docelowe sekwencje w mRNA odpowiadające SEK NR ID: 1 lub SEK NR ID:2 mogą być w nieulegających translacji regionach 5' lub 3' mRNA, jak i w regionie kodującym mRNA. [0072] Jedna lub obie nici dwuniciowego interferującego RNA mogą mieć przedłużenie 3' od 1 do 6 nukleotydów, które mogą być rybonukleotydami lub deoksyrybonukleotydami lub ich mieszaniną. Nukleotydy przedłużenia nie są sparowane z komplementarnymi zasadami. W jednym wykonaniu wynalazku interferujący RNA zawiera przedłużenie 3' TT lub UU. W innym wykonaniu wynalazku interferujący RNA zawiera przynajmniej jeden tępy koniec. Końce zazwyczaj mają grupę 5' fosforanową lub grupę 3' hydroksylową. W innych 17 EP 2 018 426 B1 5 10 15 20 25 30 35 40 45 50 wykonaniach nić antysensowna ma grupę 5' fosforanową, a nić sensowna ma grupę 5' hydroksylową. W jeszcze innych wykonaniach końce są dalej modyfikowane przez kowalencyjne dodanie innych cząsteczek lub grup funkcyjnych. [0073] Nić sensowna i nić antysensowna dwuniciowego siRNA mogą być w formie dupleksu dwóch pojedynczych nici, jak opisano powyżej, lub mogą być pojedynczą cząsteczką, gdzie regiony komplementarności mają sparowane zasady i są kowalencyjnie połączone przez pętlę szpilki do włosów tak, by wytworzyć pojedynczą nić. Uważa się, że szpilka do włosów jest cięta wewnątrzkomórkowo przez białko zwane dicer, by wytworzyć interferujący RNA z dwóch poszczególnych połączonych parowaniem zasad cząsteczek RNA. [0074] Interferujące RNA mogą różnić się od naturalnie występujących RNA przez dodanie, delecję, podstawienie lub modyfikację jednego lub więcej nukleotydów. Materiał inny niż nukleotydy może być związany z interferującym RNA, na końcu 5', końcu 3' lub wewnętrznie. Takie modyfikacje są powszechnie projektowane dla zwiększenia oporności interferującego RNA na nukleazy, by poprawić pobieranie przez komórki, by wzmagać adresowanie komórkowe, by pomóc w śledzeniu interferującego RNA, aby dalej poprawić stabilność lub by obniżyć potencjał do aktywacji szlaku interferonu. Na przykład, interferujące RNA mogą zawierać nukleotyd purynowy na końcach przedłużeń. Koniugacja cholesterolu do końca 3' nici sensownej cząsteczki siRNA na przykład za pomocą linkera pirolidynowego także nadaje stabilność siRNA. [0075] Dalsze modyfikacje obejmują na przykład 3' końcową cząsteczkę biotyny, peptyd, o którym wiadomo, że ma zdolność wnikania do komórki, nanocząsteczkę, peptydomimetyk, barwnik fluorescencyjny lub dendrymer. [0076] Nukleotydy mogą być modyfikowane na swojej części zasady, na swojej części cukru lub na części fosforanowej cząsteczki i działać w wykonaniach przedmiotowego wynalazku. Modyfikacje obejmują na przykład podstawienia grupami alkil, alkoksy, amino, deaza, halo, hydroksyl, tiol lub ich kombinacją. Nukleotydy mogą być podstawione na przykład analogami z większą stabilnością, jak przy zastąpieniu rybonukleotydu deoksyrybonukleotydem, lub mającymi modyfikacje cukrów, takie jak zastąpienie grup 2' OH przez grupy 2' amino, grupy 2' O-metyl, grupy 2' metoksyetyl lub mostek 2'-O 4'-C metylenowy. Przykłady purynowych lub pirymidynowych analogów nukleotydów obejmują ksantynę, hipoksantynę, azapurynę, metylotioadeninę, 7-deaza-adenozynę i O- i N-modyfikowane nukleotydy. Grupa fosforanowa nukleotydu może być modyfikowana przez podstawienie jednego lub więcej tlenów grupy fosforanowej azotem lub siarką (fosforotioany). Modyfikacje są pożyteczne, na przykład, do wzmagania funkcji, do poprawiania stabilności lub przepuszczalności, lub do sterowania lokalizacją lub adresowaniem. [0077] Może się zdarzyć, że region lub regiony antysensownej interferującej nici RNA nie będzie (będą) komplementarny(-e) do części SEK NR ID:1 SEK NR ID:2. Regiony niekomplementarne mogą być na końcu 3', 5' lub na obu końcach komplementarnego regionu, lub pomiędzy dwoma regionami komplementarnymi. [0078] Interferujące RNA mogą być wygenerowane egzogennie za pomocą syntezy chemicznej, za pomocą transkrypcji in vitro lub przez cięcie dłuższego dwuniciowego RNA przez dicer lub inną odpowiednią nukleazę z podobną aktywnością. Chemicznie syntetyzowane interferujące RNA, wyprodukowane z chronionych fosforoamidytów rybonukleozydów przy zastosowaniu konwencjonalnego syntetyzatora DNA/RNA, mogą być uzyskane od komercyjnych dostawców, takich jak Ambion Inc. (Austin, TX), Invitrogen (Carlsbad, CA) lub Dharmacon (Lafayette, CO). Interferujące RNA oczyszcza się na przykład przez ekstrakcję rozpuszczalnikiem lub żywicą, strącanie, elektroforezę, chromatografię lub ich kombinację. Alternatywnie, interferujący RNA może być stosowany bez lub z niewielkim oczyszczaniem, by uniknąć strat związanych z obróbką próbki. [0079] Interferujące RNA mogą także być eksprymowane endogennie z plazmidowych lub 18 EP 2 018 426 B1 5 10 15 20 25 30 35 40 45 50 wirusowych wektorów ekspresyjnych, lub z minimalnych kaset ekspresyjnych, na przykład, wygenerowanych za pomocą PCR fragmentów zawierających jeden lub więcej promotorów i odpowiednią matrycę lub matryce dla interferującego RNA. Przykłady komercyjnie dostępnych wektorów ekspresyjnych opartych na plazmidach dla shRNA obejmują członków serii pSilencer (Ambion, Austin, TX) i pCpG-siRNA (InvivoGen, San Diego, CA). Wektory wirusowe do ekspresji interferującego RNA mogą być wyprowadzone z różnych wirusów obejmujących adenowirus, wirus związany z adeno, lentiwirus (np. HIV, FIV i EIAV) i wirus opryszczki. Przykłady komercyjnie dostępnych wektorów wirusowych do ekspresji shRNA obejmują pSilencer adeno (Ambion, Austin, TX) i pLenti6/BLOCK-iT?-DEST (Invitrogen, Carlsbad, CA). Wybór wektorów wirusowych, metod ekspresji interferującego RNA z wektora i metod dostarczania wektora wirusowego są znane osobie o przeciętnych umiejętnościach w dziedzinie. Przykłady zestawów do produkcji wygenerowanych za pomocą PCR ekspresyjnych kaset shRNA obejmują Silencer Express (Ambion, Austin, TX) i siXpress (Mirus, Madison, W17). Pierwszy interferujący RNA może być podawany przez ekspresję in vivo z pierwszego wektora ekspresyjnego zdolnego do ekspresji pierwszego interferującego RNA, a drugi interferujący RNA może być podany przez ekspresję in vivo z drugiego wektora ekspresyjnego zdolnego do ekspresji drugiego interferującego RNA, lub oba interferujące RNA mogą być podane przez ekspresję in vivo z pojedynczego wektora ekspresyjnego zdolnego do ekspresji obu interferujących RNA. [0080] Interferujące RNA mogą być eksprymowane z różnych promotorów eukariotycznych znanych osobom o przeciętnych umiejętnościach w dziedzinie, obejmujących promotory pol III, takie jak promotory U6 lub H1, lub promotory pol II, takie jak promotor cytomegalowirusa. Osoby biegłe w dziedzinie rozpoznają, że te promotory mogą być także przystosowane do pozwolenia na indukowalną ekspresję interferującego RNA. [0081 Hybrydyzacja w warunkach fizjologicznych: W pewnych wykonaniach przedmiotowego wynalazku nić antysensowna interferującego RNA hybrydyzuje z mRNA in vivo jako część kompleksu RISC. [0082] Na przykład, warunki wysokiej ostrości mogą wystąpić przy około 50% formamidu w 37 °C do 42 °C. Warunki obniżonej ostrości mogą wystąpić przy około 35% do 25% formamidu w 30 °C do 35 °C. Przykłady warunków ostrości dla hybrydyzacji są podane w Sambrook, J., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Dalsze przykłady ostrych warunków hybrydyzacji obejmują 400 mM NaCl, 40 mM PIPES pH 6,4, 1 mM EDTA, 50 °C lub 70 °C przez 12-16 godzin, po czym następuje płukanie, lub hybrydyzację w 70 °C w 1XSSC lub 50 °C w 1XSSC, 50% formamidu, po czym następuje płukanie w 70 °C w 0,3XSSC, lub hybrydyzację w 70 °C w 4XSSC lub 50 °C w 4XSSC, 50% formamidu, po czym następuje płukanie w 67 °C w 1XSSC. Temperatura hybrydyzacji jest około 5-10 °C niższa niż temperatura topnienia (Tm) hybrydy, gdzie Tm jest określany dla hybryd pomiędzy 19 i 49 par zasad długości przy zastosowaniu następujących obliczeń: Tm °C = 81,5 + 16,6(log10[Na+]) + 0,41 (% G+C) - (600/N), gdzie N jest liczbą zasad w hybrydzie i [Na+] jest stężeniem jonów sodu w buforze do hybrydyzacji. [0083] Opisane powyżej oznaczenie hybrydyzacji in vitro daje metodę przewidywania, czy wiązanie między kandydującym siRNA i celem będzie miało swoistość. Jednak w kontekście kompleksu RISC swoiste cięcie celu może także zachodzić z nicią antysensowną, która nie wykazuje wysokiej ostrości dla hybrydyzacji in vitro. [0084] Jednoniciowy interferujący RNA: Jak podano powyżej, interferujące RNA ostatecznie działają jako pojedyncze nici. Stwierdzono, że jednoniciowy (ss ? ang. single-stranded) interferujący RNA przeprowadza wyciszanie mRNA, choć mniej wydajnie niż dwuniciowy RNA. Tak więc wykonania przedmiotowego wynalazku także przewidują podawanie ss interferującego RNA, który hybrydyzuje w warunkach fizjologicznych do części SEK NR 19 EP 2 018 426 B1 5 10 15 20 25 30 35 40 45 50 ID:1 lub SEK NR ID:2 i ma region przynajmniej niemal doskonałej kolejnej komplementarności przynajmniej 19 nukleotydów odpowiednio z hybrydyzującą częścią SEK NR ID:1 SEK NR ID:2. SS interferujący RNA z Tabeli 1 lub Tabeli 2 ma długość 19 do 49 nukleotydów, tak jak ds interferujący RNA cytowany powyżej. SS interferujący RNA ma 5' fosforan lub jest fosforylowany in situ lub in vivo w pozycji 5'. Określenie "5' fosforylowany" jest stosowane do opisania, na przykład, polinukleotydów lub oligonukleotydów mających grupę fosforanową połączoną przez wiązanie estrowe do C5 hydroksylu cukru (np. ryboza, deoksyryboza lub ich analog) na końcu 5' polinukleotydu lub oligonukleotydu. [0085] SS interferujące RNA są syntetyzowane chemicznie lub przez transkrypcję in vitro, lub eksprymowane endogennie z wektorów lub kaset ekspresyjnych, jak dla ds interferującego RNA. Grupy 5' fosforanowe mogą być dodane przez kinazę, lub fosforan 5' może być efektem cięcia RNA przez nukleazę. Dostarczanie jest takie, jak dla ds interferujących RNA. W jednym wykonaniu ss interferujące RNA mające chronione końce i modyfikacje oporne na nukleazę są podawane do wyciszania. SS interferujące RNA mogą być suszone do przechowywania lub rozpuszczane w roztworze wodnym. Roztwór może zawierać bufory lub sole do hamowania hybrydyzacji starterów lub do stabilizacji. [0086] Interferujący RNA typu szpilka do włosów: Interferujący RNA typu szpilka do włosów jest pojedynczą cząsteczką (np. pojedynczym łańcuchem oligonukleotydów), która zawiera zarówno nić sensowną, jak i antysensowną interferującego RNA w strukturze typu łodyżkapętla lub szpilka do włosów (np. shRNA). Na przykład, shRNA mogą być eksprymowane z wektorów DNA, w których oligonukleotydy DNA kodujące nić sensowną interferującego RNA są połączone do oligonukleotydów DNA kodujących odwrotną komplementarną antysensowną nić interferującego RNA przez krótki przerywnik. Jeśli jest to potrzebne dla wybranego wektora ekspresyjnego, mogą być dodane 3' końcowe T i nukleotydy tworzące miejsca restrykcyjne. Powstały transkrypt RNA składa się sam ze sobą, by wytworzyć strukturę typu łodyżka-pętla. [0087] Sposób podawania: Interferujący RNA może być podany na przykład poprzez aerozol, doustnie, doskórnie, śródskórnie, przez inhalację, domięśniowo, donosowo, doocznie, do płuc, dożylnie, dootrzewnowo, do nosa, do oka, do ust, do ucha, pozajelitowo, w formie plastra, podskórnie, podjęzykowo, miejscowo lub przezskórnie. [0088] Podanie może być zrealizowane bezpośrednio do oka przez podanie do tkanki ocznej, takie jak podawanie okołooczne, spojówkowe, pod pochewkę gałki ocznej, dokomorowo, doszklistkowe, dooczne, pod siatkówkę, pod spojówkę, pozagałkowe, wewnątrzkanalikowe lub nadnaczyniówkowe; przez iniekcję, przez bezpośrednie podanie do oka z zastosowaniem cewnika lub innego urządzenia do umieszczania, takiego jak pelet siatkówkowy, wstawka do oka, czopek lub implant zawierający materiał porowaty, nieporowaty lub żelatynowaty; przez miejscowe krople do oczu lub maści; lub przez urządzenie do powolnego uwalniania w ślepo zakończonym kanale lub implantowane w pobliżu twardówki (przeztwardówkowo) lub w obrębie oka. Iniekcja dokomorowa może być zrealizowana przez rogówkę do przedniej komory, by pozwolić czynnikowi na osiągnięcie siatki włókien kolagenowych w kącie przesączania oka. Iniekcja dokanalikowa może być zrealizowana do zbiorczych kanałów żył drenujących kanał Schlemma lub do kanału Schlemma. [0089] Podanie może być zrealizowane bezpośrednio do ucha przez, na przykład, miejscowe krople do ucha lub maści, urządzenia do powolnego uwalniania w uchu lub implantowane w pobliżu ucha. Miejscowe podawanie obejmuje podawanie domięśniowe w uchu i drogi podawania przez iniekcję do jamy bębenkowej i jamy ślimaka. Co więcej, czynniki mogą być podawane do ucha wewnętrznego przez umieszczenie pianki żelowej lub podobnego absorbującego i przylegającego produktu nasączonego interferującym RNA przy membranie okienka ucha środkowego/wewnętrznego lub przyległej struktury. [0090] Podanie może być zrealizowane bezpośrednio do płuc poprzez, na przykład, preparat 20 EP 2 018 426 B1 5 10 15 20 w formie aerozolu i przez inhalację na przykład przez inhalator lub nebulizator. [0091] Dalsze sposoby podawania obejmują tabletki, pigułki i kapsułki, które wszystkie mogą być formułowane przez osobę o przeciętnych umiejętnościach w dziedzinie. [0092] Osobnik: Osobnik potrzebujący leczenia stanu związanego z TNF? lub zagrożony rozwinięciem stanu związanego z TNF? jest człowiekiem lub innym ssakiem mającym związany z TNF? stan zapalny lub mającym suche oko lub zagrożonym rozwinięciem związanego z TNF? stanu zapalnego lub suchego oka. Stan zapalny związany z TNF? obejmuje na przykład alergiczne zapalenie spojówek, zapalenie oka, zapalenie skóry, zapalenie nosa lub astmę zasocjowaną z niepożądaną lub nieodpowiednią aktywnością TNFa, jak tu podano. [0093] Struktury oczne związane ze stanem związanym z TNF? mogą obejmować na przykład oko, siatkówkę, naczyniówkę oka, soczewkę, rogówkę, siatkę włókien kolagenowych w kącie przesączania oka, tęczówkę, nerw wzrokowy, głowę nerwu wzrokowego, twardówkę, komorę, komorę szklistą, ciało rzęskowe lub tylny odcinek. [0094] Osobnik może też być komórką oka, hodowlą komórek, narządem, lub narządem lub tkanką ex vivo. [0095] Formuły i Dawki: Formuły farmaceutyczne zawierają interferujące RNA lub ich sole według wynalazku do 99% wagowo zmieszane z fizjologicznie dopuszczalnym podłożem nośnika, takim jak woda, bufor, sól fizjologiczna, glicyna, kwas hialuronowy, mannitol i tym podobne. [0096] Interferujące RNA według wynalazku są podawane jako roztwory, zawiesiny lub emulsje. Dalej podano przykłady możliwych formuł będących wykonaniami przedmiotowego wynalazku. Ilość wagowo w % do 99; 0,1-99; 0,1 - 50; 0,5 -10,0 0,5 0,8 0,01 0,01 Qs pH 7,4 Qs 100 M1 Ilość wagowo w % do 99; 0,1-99; 0,1 - 50; 0,5 -10,0 1,0 0,01 0,5 q.s. do 100% Ilość wagowo w % do 99; 0, 1-99; 0,1- 50; 0,5 - 10,0 0,05 0,15 0,75 0,05 0,1 0,01 Interferujący RNA Hydroksypropylometyloceluloza Chlorek sodu Chlorek benzalkonium EDTA NaOH/HCl Oczyszczona woda (wolna od RNAzy) Interferujący RNA Sól fizjologiczna buforowana fosforanem Chlorek benzalkonium Polisorbat 80 Oczyszczona woda (wolna od RNAzy) Interferujący RNA Jednozasadowy fosforan sodu Dwuzasadowy fosforan sodu (bezwodny) Chlorek sodu Dwusodowy EDTA Cremophor EL Chlorek benzalkonium 21 EP 2 018 426 B1 HCl i/lub NaOH Oczyszczona woda (wolna od RNAzy) pH 7,3-7,4 q,s, do 100% Ilość wagowo w % do 99; 0,1-99; 0,1 - 50; 0,5 -10,0 1,0 4,0 q.s. do 100% Interferujący RNA Sól fizjologiczna buforowana fosforanem Hydroksypropylo-?-cyklodekstryna Oczyszczona woda (wolna od RNAzy) 5 10 15 20 25 30 35 40 [0097] Ogólnie, skuteczna ilość interferujących RNA wykonań według wynalazku daje zewnątrzkomórkowe stężenie na powierzchni komórki docelowej od 100 pM do 1000 nM lub od 1 nM do 400 nM, lub od 5 nM do około 100 nM, lub około 10 nM. Dawka wymagana do uzyskania tego lokalnego stężenia będzie się zmieniała w zależności od szeregu czynników, w tym metody dostarczania, miejsca dostarczania, liczby warstw komórek pomiędzy miejscem dostarczania i docelową komórką lub tkanką oraz tego, czy dostarczanie jest lokalne, czy ogólnoustrojowe, itd. Stężenie w miejscu dostarczania może być znacznie wyższe niż na powierzchni docelowej komórki lub tkanki. Miejscowe kompozycje są dostarczane do powierzchni docelowego narządu jeden do czterech razy dziennie lub w wydłużonym schemacie podawania, takim jak dziennie, tygodniowo, co dwa tygodnie, co miesiąc lub rzadziej, w zależności od rutynowej decyzji biegłego klinicysty. pH formuły wynosi około pH 4-9, lub pH 4,5 do pH 7,4. [0098] Oczekuje się, że terapeutyczne leczenie pacjentów za pomocą siRNA skierowanych przeciw mRNA TACE lub mRNA TNFR1 będzie korzystniejsze od leczenia drobnymi cząsteczkami przez zwiększenie czasu trwania działania, w ten sposób pozwalając na rzadsze podawanie i lepsze stosowanie się pacjentów do zaleceń lekarza. [0099] Skuteczna ilość formuły może zależeć od czynników takich, jak na przykład wiek, rasa i płeć osobnika, ciężkość stanu związanego z TNF?, szybkość obrotu transkryptu/białka docelowego genu, moc interferującego RNA i stabilność interferującego RNA. W jednym wykonaniu interferujący RNA jest dostarczany miejscowo do docelowego narządu i dociera do tkanki zawierającej mRNA TACE lub mRNA TNFR1 w dawce terapeutycznej, w ten sposób poprawiając proces związany z TNF?. [0100] Dopuszczalne nośniki: Dopuszczalny nośnik odnosi się do tych nośników, które co najwyżej powodują niewiele lub wcale nie powodują podrażnienia oka, zapewniają odpowiednią konserwację, o ile jest potrzebna, i dostarczają jeden lub więcej interferujących RNA według przedmiotowego wynalazku w homogennej dawce. Dopuszczalny nośnik do podawania interferującego RNA w wykonaniach według przedmiotowego wynalazku obejmują kationowe oparte na lipidach odczynniki do transfekcji TransIT?-TKO (Mirus Corporation, Madison, WI), LIPOFECTIN?, Lipofectamine, OLIGOFECTAMINE? (Invitrogen, Carlsbad, CA) lub DHARMAFECT? (Dharmacon, Lafayette, CO); polikationy takie jak polietylenoimina; kationowe peptydy takie jak Tat, poliarginina lub Penetratin (peptyd Antp); lub liposomy. Liposomy są tworzone na przykład ze standardowych tworzących pęcherzyki lipidów i sterolu, takiego jak cholesterol, i mogą zawierać cząsteczkę adresującą, taką jak monoklonalne przeciwciało mające powinowactwo wiązania do antygenów powierzchniowych komórki śródbłonka. Ponadto liposomy mogą być PEGylowanymi liposomami. [0101] Interferujące RNA mogą być dostarczane w roztworze, w zawiesinie lub w biodegradowalnych lub nie-biodegradowalnych urządzeniach do dostarczania. Interferujące RNA mogą być dostarczane same lub jako składniki zdefiniowanych kowalencyjnych 22 EP 2 018 426 B1 5 10 15 20 25 30 35 40 45 50 koniugatów. Interferujące RNA mogą też być skompleksowane z kationowymi lipidami, kationowymi peptydami lub kationowymi polimerami; skompleksowane z białkami, białkami fuzyjnymi lub domenami białek z właściwościami wiązania kwasów nukleinowych (np. protamina); lub kapsułkowane w nanocząstkach. Można uzyskać dostarczanie specyficzne względem tkanki lub komórki przez włączenie odpowiedniej reszty adresującej, takiej jak przeciwciało lub fragment przeciwciała. [0102] Do dostarczania oftalmologicznego, do oka lub do płuc, interferujący RNA może być połączony z dopuszczalnymi oftalmologicznie, optycznie lub płucnie konserwantami, współrozpuszczalnikami, związkami powierzchniowo czynnymi, związkami zwiększającymi lepkość, związkami zwiększającymi penetrację, buforami, chlorkiem sodu lub wodą, by wytworzyć wodną sterylną zawiesinę lub roztwór. Formuły roztworów można przygotować przez rozpuszczenie interferującego RNA w fizjologicznie dopuszczalnym izotonicznym wodnym buforze. Ponadto roztwory mogą zawierać dopuszczalny związek powierzchniowo czynny, by pomóc w rozpuszczaniu inhibitora. Czynniki dające lepkość, takie jak hydroksymetylo celuloza, hydroksyetylo celuloza, metyloceluloza, poliwinylopirolidon lub tym podobne mogą być dodane do kompozycji według przedmiotowego wynalazku, by poprawić retencję związku. [0103] Aby przygotować sterylną formułę maści, interferujący RNA łączy się z konserwantem i odpowiednim nośnikiem, takim jak olej mineralny, ciekła lanolina lub biała wazelina. Sterylne formuły żelowe mogą być przygotowane przez zawieszenie interferującego RNA w hydrofilowej bazie przygotowanej z kombinacji na przykład CAR.BOPOL?-940 (BF Goodrich, Charlotte, NC) lub tym podobne, zgodnie z metodami znanymi w dziedzinie. VISCOAT? (Alcon Laboratories, Inc., Fort Worth, TX) może być stosowany na przykład do iniekcji do oka. Inne kompozycje według przedmiotowego wynalazku mogą zawierać czynniki wzmagające penetrację, takie jak cremephor i TWEEN? 80 (monolaureinian sorbitanu polioksyetylenu, Sigma Aldrich, St. Louis, MO), jeśli interferujący RNA jest mniej penetrujący w interesującym narządzie lub tkance. [0104] Zestawy: Opisano tu także zestaw, który zawiera odczynniki do atenuacji ekspresji mRNA, jak tu podano, w komórce. Zestaw zawiera wektor ekspresyjny siRNA lub shRNA. Dla wektorów ekspresyjnych siRNA i nie wirusowych wektorów ekspresyjnych shRNA zestaw może też zawierać odczynnik do transfekcji lub inny odpowiedni nośnik do dostarczania. Dla wirusowych wektorów ekspresyjnych shRNA zestaw może zawierać wektor wirusowy i/lub składniki potrzebne do produkcji wektora wirusowego (np. linia komórkowa do pakowania, jak i wektor zawierający matrycę wektora wirusowego i dodatkowe wektory pomocnicze do pakowania). Zestaw może też zawierać dodatnie i ujemne kontrolne wektory ekspresyjne siRNA lub shRNA (np. nieadresujący kontrolny siRNA lub siRNA, który adresuje niespokrewniony mRNA). Zestaw może też zawierać odczynniki do oceny knockdown adresowanego genu docelowego (np. startery i sondy do ilościowego PCR do wykrycia docelowego mRNA i/lub przeciwciał przeciw odpowiedniemu białku do western blot). Alternatywnie, zestaw może zawierać sekwencję siRNA lub sekwencję shRNA oraz instrukcje i materiały potrzebne do wygenerowania siRNA za pomocą transkrypcji in vitro lub do konstrukcji wektora ekspresyjnego shRNA. [0105] Dalej opisano kombinację farmaceutyczną w formie zestawu, która zawiera, w opakowanej kombinacji, nośnik przystosowany do przyjęcia pojemnika w ścisłym zamknięciu z pierwszym nośnikiem obejmującym kompozycję interferującego RNA i dopuszczalny nośnik. Takie zestawy mogą dalej zawierać, jeśli jest to pożądane, jeden lub więcej z różnych konwencjonalnych składników zestawów farmaceutycznych, takich jak, na przykład, pojemniki z jednym lub więcej farmaceutycznie dopuszczalnym nośnikiem, dodatkowe pojemniki itd., jak będzie oczywiste dla osób biegłych w dziedzinie. Wydrukowane instrukcje, bądź jako wstawki, bądź jako etykiety, wskazujące ilości składników, które mają 23 EP 2 018 426 B1 5 10 15 20 być podane, wytyczne dla podawania i/lub wytyczne dla mieszania składników mogą także być włączone do zestawu. [0106] Zdolność interferującego RNA TACE lub TNFR1 do obniżania poziomów endogennej ekspresji TACE lub TNFR1 w, na przykład, komórkach ludzkich nabłonka rogówki jest oceniana in vitro, jak następuje. Transformowane komórki ludzkie nabłonka rogówki, na przykład linia komórkowa CEPI-17 (Offord i in. (1999) Invest Ophthalmol Vis Sci. 40:1091-1101), wysiewa się 24 godz. przed transfekcją w podłożu KGM do keratynocytów (Cambrex, East Rutherford, NJ). Transfekcję przeprowadza się, stosując DharmaFECT? 1 (Dharmacon, Lafayette, CO) zgodnie z instrukcjami producenta ze stężeniami interferującego RNA TACE lub TNFR1 w zakresie od 0,1 nM - 100 nM. Nieadresujący kontrolny interferujący RNA i interferujący RNA lamin A/C (Dharmacon) są stosowane jako kontrole. Poziomy docelowego mRNA są oceniane za pomocą qPCR 24 godz. po transfekcji przy zastosowaniu, na przykład, starterów ?forward? i ?reverse? TAQMAN? i zestawu sond, który obejmuje miejsce docelowe (Applied Biosystems, Foster City, CA). Poziomy docelowych białek można oceniać około 72 godz. po transfekcji (faktyczny czas zależy od obrotu białka) za pomocą na przykład western blot. Standardowe techniki izolacji RNA i/lub białka z hodowanych komórek są dobrze znane osobom biegłym w dziedzinie. Aby obniżyć ryzyko niespecyficznych efektów niedotyczących celu, stosuje się najniższe możliwe stężenie interferującego RNA TACE lub TNFR1, które daje pożądany poziom obniżenia ekspresji docelowego genu. Przykład 1 Interferujący RNA do swoistego wyciszania TNFR1 w komórkach GTM-3 25 30 35 40 45 [0107] To badanie bada zdolność interferującego RNA TNFR1 do obniżania poziomów ekspresji endogennego białka TNFR1 w hodowanych komórkach GTM-3. [0108] Transfekcję komórek GTM-3 (Pang, I.H. i in., 1994, Curr. Eye Res. 13:51-63) przeprowadzono, stosując standardowe stężenia in vitro (0,1- 10 nM) siRNA TNFR1, siCONTROL RISC-free siRNA #1 lub siCONTROL Non-targeting siRNA #2 (NTC2) i odczynnik do transfekcji DHARMAFECT? #1 (Dharmacon, Lafayette, CO). Wszystkie siRNA rozpuszczono w 1X buforze do siRNA, wodnym roztworze 20 mM KCI, 6 mM HEPES (pH 7,5), 0,2 mM MgCl2. Kontrolne próbki zawierały kontrolę z buforem, w której objętość siRNA zastąpiono równą objętością 1X buforu do siRNA (-siRNA). Przeprowadzono Western bloty, stosując przeciwciało anty-TNFR1 (Santa Cruz Biotechnology, Santa Cruz, CA) w celu oceny ekspresji białka TNFR1. siRNA TNFR1 są dwuniciowymi interferującymi RNA mającymi swoistość dla następujących celów: siTNFR1 #1 adresuje sekwencję CAAAGGAACCUACUUGUAC (SEK NR ID: 202), z której pochodzi SEK NR ID:96; siTNFR1 #2 adresuje sekwencję GAGCUUGAAGGAACUACUA (SEK NR ID: 203), z której pochodzi SEK NR ID:97; siTNFR1 #3 adresuje sekwencję CACAGAGCCUAGACACUGA (SEK NR ID: 204), z której pochodzi SEK NR ID:98; siTNFR1 #4 adresuje sekwencję UCCAAGCUCUACUCCAUUG (SEK NR ID: 205), z której pochodzi SEK NR ID:99. Jak pokazują dane na Figurze 1, siRNA siTNFR1 #1, siTNFR1 #2 i siTNFR1 #3 znacząco obniżały ekspresję białka TNFR1 w stężeniach 10 nM i 1 nM względem kontrolnych siRNA, ale wykazywały obniżoną skuteczność przy 0,1 nM. siRNA siTNFR1 #2 i siTNFR1 #3 były szczególnie skuteczne. siRNA siTNFR1 #4 także wykazywało zależne od stężenia obniżenie ekspresji białka TNFR1, jak oczekiwano. 24 EP 2 018 426 B1 LISTA SEKWENCJI 5 [0109] <110> Yanni, John M. Chatterton, Jon E. Senchyna, Diane Michelle Gamache, Daniel A. Miller, Steven T. <120> Hamowanie z udziałem RNAi stanów związanych z czynnikiem martwicy guzów alfa <130> 45263-P019WO 10 <160> 205 <170> PatentIn version 3.3 15 <210> 1 <211> 3572 <212> DNA <213> Homo sapiens <400> 1 20 25 EP 2 018 426 B1 26 EP 2 018 426 B1 27 EP 2 018 426 B1 5 <210> 2 <211> 2236 <212> DNA <213> Homo sapiens <400> 2 28 EP 2 018 426 B1 29 EP 2 018 426 B1 5 <210> 3 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 10 <400> 3 gctctcagac tacgatatt 15 19 <210> 4 <211> 21 <212> DNA <213> Syntetyczna <220> <223> Nić sensowna z 3'NN <220> <221> różne_RNA <222> (1)..(19) <223> rybonukleotydy <220> <221> różne_cechy 20 25 30 EP 2 018 426 B1 <222> (20)..(21) <223> dowolny, A, T/U, C, G 5 <400> 4 gcucucagac uacgauauun n <210> 5 <211> 21 <212> DNA <213> Syntetyczna <220> <223> Nić antysensowna z 3'NN 21 10 15 <220> <221> różne_RNA <222> (1)..(19) <223> rybonukleotydy <220> <221> różne_cechy <222> (20)..(21) <223> dowolny, A, T/U, C, G <400> 5 aauaucguag ucugagagcn n <210> 6 <211> 21 <212> RNA <213> Syntetyczna <220> <223> Nić sensowna 21 20 25 30 35 <400> 6 gcucucagac uacgauauuu u <210> 7 <211> 21 <212> RNA <213> Syntetyczna <220> <223> Nić antysensowna 21 40 45 <400> 7 aauaucguag ucugagagcu u 50 21 <210> 8 <211> 19 31 EP 2 018 426 B1 <212> RNA <213> Syntetyczna 5 <220> <223> Nić sensowna <400> 8 gcucucagac uacgauauu 19 10 <210> 9 <211> 19 <212> RNA <213> Syntetyczna <220> <223> Nić antysensowna <400> 9 aauaucguag ucugagagc 19 15 20 <210> 10 <211> 48 <212> DNA <213> Syntetyczna 25 <220> <223> Dupleks typu szpilka do włosów z pętlą 30 <220> <221> różne_RNA <222> (1)..(19) <223> rybonukleotydy <220> <221> różne_cechy <222> (20)..(27) <223> dowolny, A, T/U, C, G <220> <221> różne_cechy <222> (28)..(48) <223> rybonukleotydy <400> 10 gcucucagac uacgauauun nnnnnnnaau aucguagucu gagagcuu <210> 11 <211> 25 <212> DNA <213> Syntetyczna 48 35 40 45 50 32 EP 2 018 426 B1 <220> <223> Nić sensowna 5 <400> 11 gcucucagac uacgauauuc ucucu <210> 12 <211> 25 <212> RNA <213> Syntetyczna <220> <223> Nić sensowna 25 10 15 <400> 12 gcucucagac uacgauauuc ucucu 20 25 <210> 13 <211> 27 <212> RNA <213> Syntetyczna <220> <223> Nić antysensowna <400> 13 agagagaaua ucguagucug agagcuu 27 25 30 <210> 14 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 14 ccagcagcat tcggtaaga 19 35 40 <210> 15 <211> 19 <212> DNA <213> Syntetyczna 45 <220> <223> Sekwencja Docelowa 50 <400> 15 cagcagcatt cggtaagaa 19 33 EP 2 018 426 B1 5 <210> 16 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 10 <400> 16 agcagcattc ggtaagaaa <210> 17 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 19 15 20 <400> 17 agagatctac agacttcaa 25 19 <210> 18 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 18 gaaagcgagt acactgtaa 19 30 35 <210> 19 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 19 ccatgaagaa cacgtgtaa 19 40 45 <210> 20 <211> 19 <212> DNA <213> Syntetyczna 50 34 EP 2 018 426 B1 <220> <223> Sekwencja Docelowa 5 <400> 20 gaagaacacg tgtaaatta <210> 21 <211> 19 <212> DNA <213> Syntetyczna 19 10 <220> <223> Sekwencja Docelowa 15 <400> 21 atcatcgctt ctacagata <210> 22 <211> 19 <212> DNA <213> Syntetyczna 19 20 <220> <223> Sekwencja Docelowa 25 <400> 22 agagcaattt agctttgat 30 19 <210> 23 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 23 ggtttgacga gcacaaaga 19 35 40 <210> 24 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 24 tgatccggat ggtctagca 19 45 50 35 EP 2 018 426 B1 <210> 25 <211> 19 <212> DNA <213> Syntetyczna 5 <220> <223> Sekwencja Docelowa 10 <400> 25 gcgatcacga gaacaataa <210> 26 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 19 15 20 <400> 26 gcagtaaaca atcaatcta <210> 27 <211> 19 <212> DNA <213> Syntetyczna 19 25 <220> <223> Sekwencja Docelowa 30 <400> 27 caatctataa gaccattga 35 19 <210> 28 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 28 tttcaagaac gcagcaata 19 40 45 <210> 29 <211> 19 <212> DNA <213> Syntetyczna <220> 50 36 EP 2 018 426 B1 <223> Sekwencja Docelowa <400> 29 ttcaagaacg cagcaataa 5 19 <210> 30 <211> 19 <212> DNA <213> Syntetyczna 10 <220> <223> Sekwencja Docelowa 15 <400> 30 tcaagaacgc agcaataaa <210> 31 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 19 20 25 <400> 31 tcatgtatct gaacaacga <210> 32 <211> 19 <212> DNA <213> Syntetyczna 19 30 <220> <223> Sekwencja Docelowa 35 <400> 32 acagcgactg cacgttgaa 40 19 <210> 33 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 33 gattaatgct acttgcaaa 19 45 50 <210> 34 37 EP 2 018 426 B1 <211> 19 <212> DNA <213> Syntetyczna 5 <220> <223> Sekwencja Docelowa <400> 34 ctggagtcct gtgcatgta 19 10 <210> 35 <211> 19 <212> DNA <213> Syntetyczna 15 <220> <223> Sekwencja Docelowa 20 <400> 35 tggagtcctg tgcatgtaa <210> 36 <211> 19 <212> DNA <213> Syntetyczna 19 25 <220> <223> Sekwencja Docelowa 30 <400> 36 ggagtcctgt gcatgtaat <210> 37 <211> 19 <212> DNA <213> Syntetyczna 19 35 <220> <223> Sekwencja Docelowa 40 <400> 37 catgtaatga aactgacaa 45 19 <210> 38 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 50 38 EP 2 018 426 B1 <400> 38 ctatgtcgat gctgaacaa 5 19 <210> 39 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 39 caaatgtgag aaacgagta 19 10 15 <210> 40 <211> 19 <212> DNA <213> Syntetyczna 20 <220> <223> Sekwencja Docelowa 25 <400> 40 gcatcggttc gcattatca <210> 41 <211> 19 <212> DNA <213> Syntetyczna 19 30 <220> <223> Sekwencja Docelowa 35 <400> 41 atcggttcgc attatcaaa 19 <210> 42 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 40 45 <400> 42 ccaagtcatt tgaggatct 50 19 <210> 43 <211> 19 39 EP 2 018 426 B1 <212> DNA <213> Syntetyczna 5 <220> <223> Sekwencja Docelowa <400> 43 ccggtcacca gaagtgaaa 19 10 <210> 44 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 44 aaaggctgcc tcctttaaa 19 15 20 <210> 45 <211> 19 <212> DNA <213> Syntetyczna 25 <220> <223> Sekwencja Docelowa 30 <400> 45 tttaaactgc agcgtcaga <210> 46 <211> 19 <212> DNA <213> Syntetyczna 19 35 <220> <223> Sekwencja Docelowa 40 <400> 46 agatgctggt catgtgttt <210> 47 <211> 19 <212> DNA <213> Syntetyczna 19 45 <220> <223> Sekwencja Docelowa 50 40 EP 2 018 426 B1 <400> 47 atgctggtca tgtgtttga 5 19 <210> 48 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 48 tgctggtcat gtgtttgaa 19 10 15 <210> 49 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 49 ctggtcatgt gtttgaact 19 20 25 <210> 50 <211> 19 <212> DNA <213> Syntetyczna 30 <220> <223> Sekwencja Docelowa 35 <400> 50 tgtaatgaac cgctgaata <210> 51 <211> 19 <212> DNA <213> Syntetyczna 19 40 <220> <223> Sekwencja Docelowa 45 <400> 51 gtaatgaacc gctgaatat <210> 52 <211> 19 <212> DNA 19 50 41 EP 2 018 426 B1 <213> Syntetyczna <220> <223> Sekwencja Docelowa 5 <400> 52 ctaagactaa tgctctcta 10 19 <210> 53 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 53 agactaatgc tctctagaa 19 15 20 <210> 54 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 54 cctaaccacc taccttaca 19 25 30 <210> 55 <211> 19 <212> DNA <213> Syntetyczna 35 <220> <223> Sekwencja Docelowa 40 <400> 55 tacatggtag ccagttgaa <210> 56 <211> 19 <212> DNA <213> Syntetyczna 19 45 <220> <223> Sekwencja Docelowa 50 <400> 56 42 EP 2 018 426 B1 tggtagccag ttgaattta <210> 57 <211> 19 <212> DNA <213> Syntetyczna 19 5 <220> <223> Sekwencja Docelowa 10 <400> 57 tttatggaat ctaccaact 15 19 <210> 58 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 58 ggaatctacc aactgttta 19 20 25 <210> 59 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 59 accaggccgt gatctctat 19 30 35 <210> 60 <211> 19 <212> DNA <213> Syntetyczna 40 <220> <223> Sekwencja Docelowa 45 <400> 60 aattcgattt gctgtacca <210> 61 <211> 19 <212> DNA <213> Syntetyczna 19 50 43 EP 2 018 426 B1 <220> <223> Sekwencja Docelowa 5 <400> 61 tcgatttgct gtaccaagt <210> 62 <211> 19 <212> DNA <213> Syntetyczna 19 10 <220> <223> Sekwencja Docelowa 15 <400> 62 acaaaggaac ctacttgta 20 19 <210> 63 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 63 gaacctactt gtacaatga 19 25 30 <210> 64 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 64 ctacttgtac aatgactgt 19 35 40 <210> 65 <211> 19 <212> DNA <213> Syntetyczna 45 <220> <223> Sekwencja Docelowa 50 <400> 65 tgtgagagcg gctccttca 19 44 EP 2 018 426 B1 5 <210> 66 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 10 <400> 66 tcaggtggag atctcttct <210> 67 <211> 19 <212> DNA <213> Syntetyczna 19 15 <220> <223> Sekwencja Docelowa 20 <400> 67 caggtggaga tctcttctt 25 19 <210> 68 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 68 agaaccagta ccggcatta 19 30 35 <210> 69 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 69 gaaccagtac cggcattat 19 40 45 <210> 70 <211> 19 <212> DNA <213> Syntetyczna 50 45 EP 2 018 426 B1 <220> <223> Sekwencja Docelowa 5 <400> 70 aaccagtacc ggcattatt <210> 71 <211> 19 <212> DNA <213> Syntetyczna 19 10 <220> <223> Sekwencja Docelowa 15 <400> 71 ccggcattat tggagtgaa <210> 72 <211> 19 <212> DNA <213> Syntetyczna 19 20 <220> <223> Sekwencja Docelowa 25 <400> 72 cggcattatt ggagtgaaa 30 19 <210> 73 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 73 agcctggagt gcacgaagt 19 35 40 <210> 74 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 74 ctcctcttca ttggtttaa 19 45 50 46 EP 2 018 426 B1 <210> 75 <211> 19 <212> DNA <213> Syntetyczna 5 <220> <223> Sekwencja Docelowa 10 <400> 75 ttggtttaat gtatcgcta <210> 76 <211> 19 <212> DNA <213> Syntetyczna 19 15 <220> <223> Sekwencja Docelowa 20 <400> 76 gtttaatgta tcgctacca <210> 77 <211> 19 <212> DNA <213> Syntetyczna 19 25 <220> <223> Sekwencja Docelowa 30 <400> 77 tttaatgtat cgctaccaa 35 19 <210> 78 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 78 agtccaagct ctactccat 19 40 45 <210> 79 <211> 19 <212> DNA <213> Syntetyczna <220> 50 47 EP 2 018 426 B1 <223> Sekwencja Docelowa <400> 79 gagcttgaag gaactacta 5 19 <210> 80 <211> 19 <212> DNA <213> Syntetyczna 10 <220> <223> Sekwencja Docelowa 15 <400> 80 cttgaaggaa ctactacta <210> 81 <211> 19 <212> DNA <213> Syntetyczna 19 20 <220> <223> Sekwencja Docelowa 25 <400> 81 ttgaaggaac tactactaa <210> 82 <211> 19 <212> DNA <213> Syntetyczna 19 30 <220> <223> Sekwencja Docelowa 35 <400>82 acaagccaca gagcctaga 40 19 <210> 83 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 83 tgtacgccgt ggtggagaa 19 45 50 <210> 84 48 EP 2 018 426 B1 <211> 19 <212> DNA <213> Syntetyczna 5 <220> <223> Sekwencja Docelowa <400> 84 ccgttgcgct ggaaggaat 19 10 <210> 85 <211> 19 <212> DNA <213> Syntetyczna 15 <220> <223> Sekwencja Docelowa 20 <400> 85 tctaaggacc gtcctgcga <210> 86 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 19 25 30 <400> 86 ctaatagaaa cttggcact <210> 87 <211> 19 <212> DNA <213> Syntetyczna 19 35 <220> <223> Sekwencja Docelowa 40 <400> 87 taatagaaac ttggcactc 45 19 <210> 88 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 50 49 EP 2 018 426 B1 <400> 88 aatagaaact tggcactcc 5 19 <210> 89 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 89 atagaaactt ggcactcct 19 10 15 <210> 90 <211> 19 <212> DNA <213> Syntetyczna 20 <220> <223> Sekwencja Docelowa 25 <400> 90 tagaaacttg gcactcctg <210> 91 <211> 19 <212> DNA <213> Syntetyczna 19 30 <220> <223> Sekwencja Docelowa 35 <400> 91 atagcaagct gaactgtcc <210> 92 <211> 19 <212> DNA <213> Syntetyczna 19 40 <220> <223> Sekwencja Docelowa 45 <400> 92 tagcaagctg aactgtcct 50 19 <210> 93 <211> 19 50 EP 2 018 426 B1 <212> DNA <213> Syntetyczna 5 <220> <223> Sekwencja Docelowa <400> 93 agcaagctga actgtccta 19 10 <210> 94 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 94 gcaagctgaa ctgtcctaa 19 15 20 <210> 95 <211> 19 <212> DNA <213> Syntetyczna 25 <220> <223> Sekwencja Docelowa 30 <400> 95 tgaactgtcc taaggcagg <210> 96 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 19 35 40 <400> 96 caaaggaacc tacttgtac <210> 97 <211> 19 <212> DNA <213> Syntetyczna 19 45 <220> <223> Sekwencja Docelowa 50 51 EP 2 018 426 B1 <400> 97 gagcttgaag gaactacta 5 19 <210> 98 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 98 cacagagcct agacactga 19 10 15 <210> 99 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 99 tccaagctct actccattg 19 20 25 <210> 100 <211> 19 <212> DNA <213> Syntetyczna 30 <220> <223> Sekwencja Docelowa 35 <400> 100 tggagctgtt ggtgggaat <210> 101 <211> 19 <212> DNA <213> Syntetyczna 19 40 <220> <223> Sekwencja Docelowa 45 <400> 101 gacagggaga agagagata <210> 102 <211> 19 <212> DNA 19 50 52 EP 2 018 426 B1 <213> Syntetyczna <220> <223> Sekwencja Docelowa 5 <400> 102 gggagaagag agatagtgt 10 19 <210> 103 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 103 gagaagagag atagtgtgt 19 15 20 <210> 104 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 104 gaagagagat agtgtgtgt 19 25 30 <210> 105 <211> 19 <212> DNA <213> Syntetyczna 35 <220> <223> Sekwencja Docelowa 40 <400> 105 gtgtgtgtcc ccaaggaaa <210> 106 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 19 45 50 <400> 106 53 EP 2 018 426 B1 gaaaatatat ccaccctca <210> 107 <211> 19 <212> DNA <213> Syntetyczna 19 5 <220> <223> Sekwencja Docelowa 10 <400> 107 aaatatatcc accctcaaa 15 19 <210> 108 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 108 ctgtaccaag tgccacaaa 19 20 25 <210> 109 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 109 accaagtgcc acaaaggaa 19 30 35 <210> 110 <211> 19 <212> DNA <213> Syntetyczna 40 <220> <223> Sekwencja Docelowa 45 <400> 110 ccaagtgccacaaaggaac <210> 111 <211> 19 <212> DNA <213> Syntetyczna 19 50 54 EP 2 018 426 B1 <220> <223> Sekwencja Docelowa 5 <400> 111 ccacaaaggaacctacttg <210> 112 <211> 19 <212> DNA <213> Syntetyczna 19 10 <220> <223> Sekwencja Docelowa 15 <400> 112 caaaggaacc tacttgtac 20 19 <210> 113 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 113 aaaggaacct acttgtaca 19 25 30 <210> 114 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 114 gatacggact gcagggagt 19 35 40 <210> 115 <211> 19 <212> DNA <213> Syntetyczna 45 <220> <223> Sekwencja Docelowa 50 <400> 115 cggactgcag ggagtgtga 19 55 EP 2 018 426 B1 5 <210> 116 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 10 <400> 116 tccttcaccg cttcagaaa <210> 117 <211> 19 <212> DNA <213> Syntetyczna 19 15 <220> <223> Sekwencja Docelowa 20 <400> 117 cagaaaacca cctcagaca 25 19 <210> 118 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 118 tgcctcagct gctccaaat 19 30 35 <210> 119 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 119 ctccaaatgc cgaaaggaa 19 40 45 <210> 120 <211> 19 <212> DNA <213> Syntetyczna 50 56 EP 2 018 426 B1 <220> <223> Sekwencja Docelowa 5 <400> 120 tccaaatgccgaaaggaaa <210> 121 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 19 10 15 <400> 121 ccaaatgccg aaaggaaat <210> 122 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 19 20 25 <400> 122 gccgaaagga aatgggtca 30 19 <210> 123 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 123 aggaaatggg tcaggtgga 19 35 40 <210> 124 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 124 ggaaatgggt caggtggag <210> 125 19 45 50 57 EP 2 018 426 B1 <211> 19 <212> DNA <213> Syntetyczna 5 <220> <223> Sekwencja Docelowa <400> 125 gtgtgtggct gcaggaaga 19 10 <210> 126 <211> 19 <212> DNA <213> Syntetyczna 15 <220> <223> Sekwencja Docelowa 20 <400> 126 ggaagaacca gtaccggca <210> 127 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 19 25 30 <400> 127 ccatgcaggt ttctttcta <210> 128 <211> 19 <212> DNA <213> Syntetyczna 19 35 <220> <223> Sekwencja Docelowa 40 <400> 128 catgcaggtt tctttctaa 45 19 <210> 129 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 50 58 EP 2 018 426 B1 <400> 129 tgcaggtttc tttctaaga 5 19 <210> 130 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 130 aggtttcttt ctaagagaa 19 10 15 <210> 131 <211> 19 <212> DNA <213> Syntetyczna 20 <220> <223> Sekwencja Docelowa 25 <400> 131 ggtttctttc taagagaaa <210> 132 <211> 19 <212> DNA <213> Syntetyczna 19 30 <220> <223> Sekwencja Docelowa 35 <400> 132 agagaaaacg agtgtgtct <210> 133 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 19 40 45 <400> 133 gagtgtgtct cctgtagta 50 19 <210> 134 <211> 19 59 EP 2 018 426 B1 <212> DNA <213> Syntetyczna 5 <220> <223> Sekwencja Docelowa <400> 134 ctgtagtaac tgtaagaaa 19 10 <210> 135 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 135 agaaaagcct ggagtgcac 19 15 20 <210> 136 <211> 19 <212> DNA <213> Syntetyczna 25 <220> <223> Sekwencja Docelowa 30 <400> 136 ttgagaatgt taagggcac <210> 137 <211> 19 <212> DNA <213> Syntetyczna 19 35 <220> <223> Sekwencja Docelowa 40 <400> 137 tgttaagggc actgaggac <210> 138 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 19 45 50 60 EP 2 018 426 B1 <400> 138 ggtcattttc tttggtctt 5 19 <210> 139 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 139 cctcctcttc attggttta 19 10 15 <210> 140 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 140 tcctcttcat tggtttaat 19 20 25 <210> 141 <211> 19 <212> DNA <213> Syntetyczna 30 <220> <223> Sekwencja Docelowa 35 <400> 141 ctcttcattg gtttaatgt <210> 142 <211> 19 <212> DNA <213> Syntetyczna 19 40 <220> <223> Sekwencja Docelowa 45 <400> 142 tcttcattgg tttaatgta <210> 143 <211> 19 <212> DNA 19 50 61 EP 2 018 426 B1 <213> Syntetyczna <220> <223> Sekwencja Docelowa 5 <400> 143 cttcattggt ttaatgtat 10 19 <210> 144 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 144 tccaagctct actccattg 19 15 20 <210> 145 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 145 ctccattgtt tgtgggaaa 19 25 30 <210> 146 <211> 19 <212> DNA <213> Syntetyczna 35 <220> <223> Sekwencja Docelowa 40 <400> 146 gggaaatcga cacctgaaa <210> 147 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 19 45 50 <400> 147 62 EP 2 018 426 B1 tgaaggaact actactaag <210> 148 <211> 19 <212> DNA <213> Syntetyczna 19 5 <220> <223> Sekwencja Docelowa 10 <400> 148 acctccagct ccacctata 15 19 <210> 149 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 149 cccacaagcc acagagcct 19 20 25 <210> 150 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 150 acgccgtggt ggagaacgt 19 30 35 <210> 151 <211> 19 <212> DNA <213> Syntetyczna 40 <220> <223> Sekwencja Docelowa 45 <400> 151 ggaaggaatt cgtgcggcg <210> 152 <211> 19 <212> DNA <213> Syntetyczna 19 50 63 EP 2 018 426 B1 <220> <223> Sekwencja Docelowa 5 <400> 152 tgagcgacca cgagatcga <210> 153 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 19 10 15 <400> 153 gcgaggcgca atacagcat 20 19 <210> 154 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 154 tgggctgcct ggaggacat 19 25 30 <210> 155 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 155 catcaagtac tgaacgttt 19 35 40 <210> 156 <211> 19 <212> DNA <213> Syntetyczna 45 <220> <223> Sekwencja Docelowa 50 <400> 156 tcgtggtggt ggatggtaa 19 64 EP 2 018 426 B1 5 <210> 157 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 10 <400> 157 gaaagcgagt acactgtaa <210> 158 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 19 15 20 <400> 158 gagcctgact ctagggttc 25 19 <210> 159 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 159 ccacataaga gatgatgat 19 30 35 <210> 160 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 160 cataagagat gatgatgtt 19 40 45 <210> 161 <211> 19 <212> DNA <213> Syntetyczna 50 65 EP 2 018 426 B1 <220> <223> Sekwencja Docelowa 5 <400> 161 cgaatataac atagagcca <210> 162 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 19 10 15 <400> 162 gttaatgata ccaaagaca <210> 163 <211> 19 <212> DNA <213> Syntetyczna 19 20 <220> <223> Sekwencja Docelowa 25 <400> 163 ctgaagatat caagaatgt 30 19 <210> 164 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 164 atgaagagtt gctcccaaa 19 35 40 <210> 165 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 165 atgaagaaca cgtgtaaat 19 45 50 66 EP 2 018 426 B1 <210> 166 <211> 19 <212> DNA <213> Syntetyczna 5 <220> <223> Sekwencja Docelowa 10 <400> 166 aattattggt ggtagcaga <210> 167 <211> 19 <212> DNA <213> Syntetyczna 19 15 <220> <223> Sekwencja Docelowa 20 <400> 167 atcatcgctt ctacagata <210> 168 <211> 19 <212> DNA <213> Syntetyczna 19 25 <220> <223> Sekwencja Docelowa 30 <400> 168 atacatgggc agaggggaa 35 19 <210> 169 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 169 gggcagaggg gaagagagt 19 40 45 <210> 170 <211> 19 <212> DNA <213> Syntetyczna <220> 50 67 EP 2 018 426 B1 <223> Sekwencja Docelowa <400> 170 ggaagagagt acaactaca 5 19 <210> 171 <211> 19 <212> DNA <213> Syntetyczna 10 <220> <223> Sekwencja Docelowa 15 <400> 171 gaagagagta caactacaa <210> 172 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 19 20 25 <400> 172 gagagtacaa ctacaaatt <210> 173 <211> 19 <212> DNA <213> Syntetyczna 19 30 <220> <223> Sekwencja Docelowa 35 <400> 173 gctaattgac agagttgat 40 19 <210> 174 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 174 cggaacactt catgggata 19 45 50 <210> 175 68 EP 2 018 426 B1 <211> 19 <212> DNA <213> Syntetyczna 5 <220> <223> Sekwencja Docelowa <400> 175 ggataatgca ggttttaaa 19 10 <210> 176 <211> 19 <212> DNA <213> Syntetyczna 15 <220> <223> Sekwencja Docelowa 20 <400> 176 aggctatgga atacagata <210> 177 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 19 25 30 <400> 177 gaatacagat agagcagat <210> 178 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 19 35 40 <400> 178 ggtaaaacct ggtgaaaag 45 19 <210> 179 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 50 69 EP 2 018 426 B1 <400> 179 gtgaaaagca ctacaacat 5 19 <210> 180 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 180 gaggaagcat ctaaagttt 19 10 15 <210> 181 <211> 19 <212> DNA <213> Syntetyczna 20 <220> <223> Sekwencja Docelowa 25 <400> 181 tatgggaact cttggatta <210> 182 <211> 19 <212> DNA <213> Syntetyczna 19 30 <220> <223> Sekwencja Docelowa 35 <400> 182 tgacgagcac aaagaatta <210> 183 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 19 40 45 <400> 183 gcacaaagaa ttatggtaa 50 19 <210> 184 <211> 19 70 EP 2 018 426 B1 <212> DNA <213> Syntetyczna 5 <220> <223> Sekwencja Docelowa <400> 184 ggttacaact catgaattg 19 10 <210> 185 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 185 actcatgaat tgggacata 19 15 20 <210> 186 <211> 19 <212> DNA <213> Syntetyczna 25 <220> <223> Sekwencja Docelowa 30 <400> 186 gtggcgatca cgagaacaa <210> 187 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 19 35 40 <400> 187 ctataagacc attgaaagt <210> 188 <211> 19 <212> DNA <213> Syntetyczna 19 45 <220> <223> Sekwencja Docelowa 50 71 EP 2 018 426 B1 <400> 188 gaacgcagca ataaagttt 5 19 <210> 189 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 189 gcaataaagt ttgtgggaa 19 10 15 <210> 190 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 190 caataaagtt tgtgggaac 19 20 25 <210> 191 <211> 19 <212> DNA <213> Syntetyczna 30 <220> <223> Sekwencja Docelowa 35 <400> 191 gagggtggat gaaggagaa <210> 192 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 19 40 45 <400> 192 ggatgaagga gaagagtgt <210> 193 <211> 19 <212> DNA 19 50 72 EP 2 018 426 B1 <213> Syntetyczna <220> <223> Sekwencja Docelowa 5 <400> 193 gcatcatgta tctgaacaa 10 19 <210> 194 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 194 caggaaatgc tgaagatga 19 15 20 <210> 195 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 195 gaatggcaaa tgtgagaaa 19 25 30 <210> 196 <211> 19 <212> DNA <213> Syntetyczna 35 <220> <223> Sekwencja Docelowa 40 <400> 196 ggatgtaatt gaacgattt <210> 197 <211> 19 <212> DNA <213> Syntetyczna 19 45 <220> <223> Sekwencja Docelowa 50 <400> 197 73 EP 2 018 426 B1 gtggataaga aattggata <210> 198 <211> 19 <212> DNA <213> Syntetyczna 19 5 <220> <223> Sekwencja Docelowa 10 <400> 198 ggataaacag tatgaatct 15 19 <210> 199 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 199 cctttaaact gcagcgtca 19 20 25 <210> 200 <211> 19 <212> DNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 200 cgtgttgaca gcaaagaaa 19 30 35 <210> 201 <211> 19 <212> DNA <213> Syntetyczna 40 <220> <223> Sekwencja Docelowa 45 <400> 201 gcaaagaaac agagtgcta <210> 202 <211> 19 <212> RNA <213> Syntetyczna 19 50 74 EP 2 018 426 B1 <220> <223> Sekwencja Docelowa 5 <400> 202 caaaggaacc uacuuguac <210> 203 <211> 19 <212> RNA <213> Syntetyczna <220> <223> Sekwencja Docelowa 19 10 15 <400> 203 gagcuugaag gaacuacua 20 19 <210> 204 <211> 19 <212> RNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 204 cacagagccu agacacuga 19 25 30 <210> 205 <211> 19 <212> RNA <213> Syntetyczna <220> <223> Sekwencja Docelowa <400> 205 uccaagcucu acuccauug 19 35 40 75 EP 2 018 426 B1 Zastrzeżenia patentowe 5 1. Interferujący RNA mający długość 19 do 49 nukleotydów, gdzie interferujący RNA adresuje mRNA odpowiadający dowolnej z SEK NR ID:3, SEK NR ID:14 - SEK NR ID:58 i SEK NR ID:155 - SEK NR ID:201, do stosowania w leczeniu lub zapobieganiu stanowi oczu związanemu z TNF? u potrzebującego tego osobnika, gdzie ten stan jest suchym okiem, alergicznym zapaleniem spojówek lub zapaleniem oka. 2. Interferujący RNA mający długość 19 do 49 nukleotydów, który to interferujący RNA zawiera: sensowną nić nukleotydów, antysensowną nić nukleotydów i region przynajmniej niemal doskonałej kolejnej komplementarności przynajmniej 19 nukleotydów; gdzie nić antysensowna hybrydyzuje w warunkach fizjologicznych do części mRNA odpowiadającej SEK NR ID:1 obejmującej nukleotyd 297, 333, 334, 335, 434, 470, 493, 547, 570, 573, 618, 649, 689, 755, 842, 844, 846, 860, 878, 894, 900, 909, 910, 913, 942, 970, 984, 1002, 1010, 1053, 1064, 1137, 1162, 1215, 1330, 1334, 1340, 1386, 1393, 1428, 1505, 1508, 1541, 1553, 1557, 1591, 1592, 1593, 1597, 1604, 1605, 1626, 1632, 1658, 1661, 1691, 1794, 1856, 1945, 1946, 1947, 1958, 2022, 2094, 2100, 2121, 2263, 2277, 2347, 2349, 2549, 2578, 2595, 2606, 2608, 2629, 2639, 2764, 2766, 2767, 2769, 3027, 3028, 3261, 3264, 3284, 3313, 3317, 3332 lub 3337 do stosowania w leczeniu lub zapobieganiu stanowi oczu związanemu z TNF? u potrzebującego tego osobnika, gdzie ten stan jest suchym okiem, alergicznym zapaleniem spojówek lub zapaleniem oka. 3. Interferujący RNA mający długość 19 do 49 nukleotydów, który to interferujący RNA zawiera: sensowną nić nukleotydów, antysensowną nić nukleotydów i region przynajmniej niemal doskonałej kolejnej komplementarności przynajmniej 19 nukleotydów; gdzie nić antysensowna hybrydyzuje w warunkach fizjologicznych do części mRNA odpowiadającej SEK NR ID:2 począwszy od nukleotydu 124, 328, 387, 391, 393, 395, 406, 421, 423, 444, 447, 455, 459, 460, 467, 469, 470, 471, 475, 479, 513, 517, 531, 543, 556, 576, 587, 588, 589, 595, 601, 602, 611, 612, 651, 664, 667, 668, 669, 677, 678, 785, 786, 788, 791, 792, 804, 813, 824, 838, 843, 877, 884, 929, 959, 960, 961, 963, 964, 965, 970, 973, 974, 1000, 1002, 1013, 1026, 1053, 1056, 1057, 1058, 1161, 1315, 1318, 1324, 1357, 1360, 1383, 1393, 1420, 1471, 1573, 1671, 2044, 2045, 2046, 2047, 2048, 2089, 2090, 2091 lub 2092 do stosowania w leczeniu lub zapobieganiu stanowi oczu związanemu z TNF? u potrzebującego tego osobnika, gdzie ten stan jest suchym okiem, alergicznym zapaleniem spojówek lub zapaleniem oka. 4. Interferujący RNA do stosowania według zastrz. 2, zawierający ponadto drugi interferujący RNA mający długość 19 do 49 nukleotydów i zawierający: sensowną nić nukleotydów, antysensowną nić nukleotydów i region przynajmniej niemal doskonałej kolejnej komplementarności przynajmniej 19 nukleotydów; gdzie nić antysensowna drugiego interferującego RNA hybrydyzuje w warunkach fizjologicznych do części mRNA odpowiadającej SEK NR ID:2 obejmującej nukleotyd 124, 328, 387, 391, 393, 395, 406, 421, 423, 444, 447, 455, 459, 460, 467, 469, 470, 471, 475, 479, 513, 517, 531, 543, 556, 576, 587, 588, 589, 595, 601, 602, 611, 612, 651, 664, 667, 668, 669, 677, 678, 785, 786, 788, 791, 792, 804, 813, 824, 838, 843, 877, 884, 929, 959, 960, 961, 963, 964, 965, 970, 973, 974, 1000, 1002, 1013, 1026, 1053, 1056, 1057, 1058, 1161, 1315, 1318, 1324, 1357, 1360, 1383, 1393, 1420, 1471, 1573, 1671, 2044, 2045, 2046, 2047, 2048, 2089, 2090, 2091 lub 2092. 5. Interferujący RNA do stosowania według zastrz. 3, zawierający ponadto drugi interferujący RNA mający długość 19 do 49 nukleotydów i zawierający: sensowną nić nukleotydów, 10 15 20 25 30 35 40 45 50 76 EP 2 018 426 B1 5 10 antysensowną nić nukleotydów i region przynajmniej niemal doskonałej kolejnej komplementarności przynajmniej 19 nukleotydów; gdzie nić antysensowna drugiego interferującego RNA hybrydyzuje w warunkach fizjologicznych do części mRNA odpowiadającej SEK NR ID:1 obejmującej nukleotyd 297, 333, 334, 335, 434, 470, 493, 547, 570, 573, 618, 649, 689, 755, 842, 844, 846, 860, 878, 894, 900, 909, 910, 913, 942, 970, 984, 1002, 1010, 1053, 1064, 1137, 1162, 1215, 1330, 1334, 1340, 1386, 1393, 1428, 1505, 1508, 1541, 1553, 1557, 1591, 1592, 1593, 1597, 1604, 1605, 1626, 1632, 1658, 1661, 1691, 1794, 1856, 1945, 1946, 1947, 1958, 2022, 2094, 2100, 2121, 2263, 2277, 2347, 2349, 2549, 2578, 2595, 2606, 2608, 2629, 2639, 2764, 2766, 2767, 2769, 3027, 3028, 3261, 3264, 3284, 3313, 3317, 3332 lub 3337, gdzie interferujący RNA jest przeznaczony do podawania do oka osobnika. 6. Interferujący RNA do stosowania według zastrz. 2 lub 3, gdzie sensowna nić nukleotydów i antysensowna nić nukleotydów są połączone przez pętlę nici nukleotydów. 15 20 7. Dwuniciowa cząsteczka siRNA, która obniża ekspresję genu TACE przez interferencję RNA, gdzie: każda nić cząsteczki siRNA ma niezależnie około 19 do około 27 nukleotydów długości; i jedna nić cząsteczki siRNA obejmuje sekwencję nukleotydów mających znaczną komplementarność do mRNA odpowiadającego genowi TACE tak, że cząsteczka siRNA steruje cięciem mRNA przez interferencję RNA do stosowania w leczeniu lub zapobieganiu stanowi oczu związanemu z TNF? u potrzebującego tego osobnika, gdzie ten stan jest suchym okiem, alergicznym zapaleniem spojówek lub zapaleniem oka. 8. Dwuniciowa cząsteczka siRNA, która obniża ekspresję genu TNFR1 przez interferencję RNA, gdzie: każda nić cząsteczki siRNA ma niezależnie około 19 do około 27 nukleotydów długości; i jedna nić cząsteczki siRNA obejmuje sekwencję nukleotydów mających znaczną komplementarność do mRNA odpowiadającego genowi TACE tak, że cząsteczka siRNA staruje cięciem mRNA przez interferencję RNA do stosowania w leczeniu lub zapobieganiu stanowi oczu związanemu z TNF? u potrzebującego tego osobnika, gdzie ten stan jest suchym okiem, alergicznym zapaleniem spojówek lub zapaleniem oka. 9. Jednoniciowy interferujący RNA mający długość 19 do 49 nukleotydów, gdzie jednoniciowy interferujący RNA hybrydyzuje w warunkach fizjologicznych do części mRNA odpowiadającej SEK NR ID:1 obejmującej nukleotyd 297, 333, 334, 335, 434, 470, 493, 547, 570, 573, 618, 649, 689, 755, 842, 844, 846, 860, 878, 894, 900, 909, 910, 913, 942, 970, 984, 1002, 1010, 1053, 1064, 1137, 1162, 1215, 1330, 1334, 1340, 1386, 1393, 1428, 1505, 1508, 1541, 1553, 1557, 1591, 1592, 1593, 1597, 1604, 1605, 1626, 1632, 1658, 1661, 1691, 1794, 1856, 1945, 1946, 1947, 1958, 2022, 2094, 2100, 2121, 2263, 2277, 2347, 2349, 2549, 2578, 2595, 2606, 2608, 2629, 2639, 2764, 2766, 2767, 2769, 3027, 3028, 3261, 3264, 3284, 3313, 3317, 3332 lub 3337 i interferujący RNA ma region przynajmniej niemal doskonałej kolejnej komplementarności z hybrydyzującą częścią mRNA odpowiadającą SEK NR ID:1, do stosowania w leczeniu lub zapobieganiu stanowi oczu związanemu z TNF? u potrzebującego tego osobnika, gdzie ten stan jest suchym okiem, alergicznym zapaleniem spojówek lub zapaleniem oka. 10. Interferujący RNA do stosowania według dowolnego z zastrz. 1 do 6, gdzie interferujący RNA jest podawany przez ekspresję in vivo z wektora ekspresyjnego zdolnego do ekspresji interferującego RNA. 25 30 35 40 45 50 11. Interferujący RNA do stosowania według zastrz. 3, gdzie interferujący RNA jest 77 EP 2 018 426 B1 podawany przez wektor ekspresyjny zdolny do ekspresji interferującego RNA in vivo i gdzie każda nić cząsteczki siRNA ma niezależnie około 19 nukleotydów do około 25 nukleotydów długości lub około 19 nukleotydów do około 21 nukleotydów długości. 5 12. Interferujący RNA do stosowania według dowolnego z zastrz. 1 do 6, 10 i 11, gdzie interferujący RNA jest shRNA lub siRNA. 10 Pełnomocnik: Hanna Dreszer-Lichańska
















































































ANKIETA

Jak oceniasz nowe technologie na mundialu?

Grupy dyskusyjne