Najpopularniejszy w Polsce portal o finansach i biznesie
Money.plTechnologie dla biznesuPrzemysłPatentyEP 1747023 T5
Wyszukiwarka patentów
  • od
  • do
Patent EP 1747023 T5


EP 1747023 T5

RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (96) Data i numer zgłoszenia patentu europejskiego: 03.05.2005 05749437.9 (11) PL/EP (13) (51) 1747023 T5 Int.Cl. C12N 15/113 (2010.01) A61K 31/712 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (54) (97) O udzieleniu patentu europejskiego ogłoszono: 05.01.2011 Europejski Biuletyn Patentowy 2011/01 EP 1747023 B1 A61P 31/14 (2006.01) Tytuł wynalazku: Sposób i kompozycje do zmniejszania ilości genomu wirusowego HCV w komórkach docelowych (30) (43) Pierwszeństwo: 04.05.2004 US 568358 P Zgłoszenie ogłoszono: 31.01.2007 w Europejskim Biuletynie Patentowym nr 2007/05 (45) O złożeniu tłumaczenia patentu ogłoszono: 31.08.2011 Wiadomości Urzędu Patentowego 2011/08 (47) O złożeniu tłumaczenia zmienionego ogłoszono: 31.05.2017 Wiadomości Urzędu Patentowego 2017/05 (73) Uprawniony z patentu: The Board of Trustees of the Leland Stanford Junior University, Palo Alto, US PL/EP 1747023 T5 (72) Twórca(y) wynalazku: PETER SARNOW, Palo Alto, US CATHERINE L. JOPLING, San Francisco, US ALISSA M. LANCASTER, Portland, US (74) Pełnomocnik: rzecz. pat. Aleksandra Twardowska-Czerwińska KANCELARIA PATENTOWA KULIKOWSKA & KULIKOWSKI SP. J. ul. Nowogrodzka 47 A 00-695 Warszawa Uwaga: W ciągu dziewięciu miesięcy od publikacji informacji o udzieleniu patentu europejskiego, każda osoba może wnieść do Europejskiego Urzędu Patentowego sprzeciw dotyczący udzielonego patentu europejskiego. Sprzeciw wnosi się w formie uzasadnionego na piśmie oświadczenia. Uważa się go za wniesiony dopiero z chwilą wniesienia opłaty za sprzeciw (Art. 99 (1) Konwencji o udzielaniu patentów europejskich). 20930/PE/16 EP 1 747 023 B2 Opis WPROWADZENIE Tło wynalazku [0001] Infekcje wirusowe stanowią nieustanny problem medyczny, ponieważ podobnie jak każdy gwałtownie namnażający się czynnik zakaźny ciągle ulegają one mutacjom, które pomagają pewnym subpopulacjom wirusów utrzymać oporność na obecnie stosowane sposoby leczenia. Na wiele chorób związanych z zakażeniem wirusowym nie ma skutecznego sposobu leczenia przeciwwirusowego, ponieważ stosowane sposoby leczenia skierowane są przeciwko objawom choroby wirusowej, a nie przeciwko istnieje przyczynie potrzeba tej odkrycia choroby. i W stanie opracowania nowych techniki terapii przeciwwirusowych. [0002] Mikrocząsteczki RNA - mikroRNA (miRNA) stanowią klasę małych cząsteczek RNA, o długości około 21-22 nukleotydów, które wykryto u wielu gatunków roślin i zwierząt. Co więcej, stwierdzono, że zwierzęcych kodują klonowaniu oraz pewne genomy miRNA. wirusowego Intensywne przewidywania RNA badania oparte na wirusów oparte na modelowaniu komputerowym wykazały, że u ludzi prawdopodobnie występuje ponad 200 genów kodujących miRNA, które mogą regulować około 1000-2000 cząsteczek mRNA. Pewne miRNA ulegają ekspresji w całym organizmie, podczas gdy ekspresja innych jest wysoko tkankowospecyficzna. Na przykład, zaobserwowano, że miR-122 ulega ekspresji specyficznie w wątrobie, gdzie stanowi 70% całkowitej populacji miRNA. 2 Literatura dotycząca tematu [0003] Tomari & Zamore, Genes Dev. 19, 517 (2005); Bennasser, i wsp., Retrovirology 1, 43 (2004); Pfeffer i wsp., Science 304, 734 (2004); Baskerville & Bartel, RNA 11, 241 (2005); John i wsp., PLoS Biol. 2; e363 (2004); Lim i wsp., Nature 433, 769 (2005); Hutvagner, Science 297, 2056 (2002); Yekta, i wsp., Science 304, 594 (2004); Chen, Science 303, 2022 (2004); Doench, i wsp., Genes Dev. 17, 438 (2003); Doench & Sharp, Genes Dev. 18, 504 (2004); Olsen, Dev. Biol. 216, 671 (1999); Saxena & Dutta, J. Biol. Chem. 278, 44312 (2003); Zeng, i wsp., Proc. Nat?l. Acad. Sci. U S A 100, 9779 (2003); Lagos-Quintana i wsp., Curr. Biol. 12, 735 (2002); Sempere i wsp., Genome Biol. 5, R13 (2004); Chang, i wsp., RNA Biology 1, 106 (2004); Lewis, i wsp., Cell 120, 15 (2005); Lewis i wsp., Cell 115, 787 (2003); Ikeda, i wsp., J. Virol. 76, 2997 (2002). Friebe, i wsp., J. Virol. 75, 12047 (2001); Sunkar, i wsp., Plant Cell 16, 2001 (2004). [0004] WO 02/081494 dotyczy antysensowych cząsteczek kwasu nukleinowego, stabilność Nature, 418 które HCV modulują syntezę, albo HBV. Praca (6893), str. 38-39, ekspresję McCaffrey?a, dotyczy A. i hamowania i/lub wsp., wirusa zapalenia wątroby typu C poprzez interferencję RNA (RNAi) u myszy. STRESZCZENIE WYNALAZKU [0005] Przedmiotem wynalazku są środki hamujące miR122 do zastosowania do leczenia organizmu gospodarza cierpiącego na chorobę związaną z zakażeniem HCV, którym to środkiem jest antysensowy oligonukleotyd wiążący się z miR122. Inne aspekty wynalazku zostały zdefiniowane w zastrzeżeniach. 3 [0006] W opisie ujawniono sposoby i kompozycje do zmniejszania ilości wirusowego genomu w komórce docelowej. W przedmiotowych sposobach aktywność miRNA jest hamowana w sposób wystarczający do obniżenia ilości genomu wirusowego w komórce docelowej, np. przez wprowadzenie środka hamującego miRNA do komórki docelowej. Ujawniono tu również kompozycje farmaceutyczne, zestawy i układy do zastosowania w realizacji sposobów według szerokie wynalazku. zastosowanie, Przedmiot obejmujące wynalazku leczenie może mieć pacjentów cierpiących na choroby związane z zakażeniem wirusowym, np. stan chorobowy związany z HCV. KRÓTKI OPIS RYSUNKU [0007] Fig. 1A-1C. miR-122 ulega ekspresji w komórkach Huh7 i ma dwa Analiza przewidywane Northern blot miejsca wiążące ekspresji w miR-122 genomie w HCV. (A) całkowitym RNA wyodrębnionym z mysiej i ludzkiej wątroby oraz komórek HeLa, HepG2 i Huh7: natywnych, poddawanych leczeniu i zawierających replikon. (B) Sekwencja miR-122 zawierająca sekwencję seed wskazaną w prostokątnej ramce. (C) Struktura drugorzędowa niekodujących regionów 3? i 5? genotypu 1 HCV szczep H77c, ze wskazaniem przewidywanych Dopasowania w regionie seed miejsc wiążących miR-122. przedstawiono w prostokątnych ramkach. [0008] Fig. 2A-C. Sekwestracja miR-122 zmniejsza ilość RNA i białek HCV w komórkach replikonu. (A) Analiza Northern blot RNA replikonu, eGFP i aktyny w linii komórkowej replikonu NNeo/C-5B. Przedstawiono organizację replikonu. Do komórek, przy pomocy transfekcji za pośrednictwem lipofektaminy 2000, wprowadzano plazmidy zawierające wskaźnik eGFP i 2?-O- 4 metylowane oligonukleotydy i ekstrahowano całkowite RNA po 48 godzinach, eGFP-124 i eGFP-122 stanowią wektory ekspresyjne eGFP z miejscami komplementarnymi dla, odpowiednio, miR-124 i miR-122 w 3?UTR. 122-2?OMe jest 31-merowym 2?-O-metylowanym oligomerem komplementarnym randomizowaną odmianą dla tej miR-122, sekwencji, a Rand-2?OMe jest let7-2?OMe jest podobnym oligomerem komplementarnym dla let-7a. (B) Analiza Western blot przedstawiająca poziomy białka rdzeniowego HCV, eGFP i aktyny po 48 godzinach od transfekcji określonymi plazmidami ze wskaźnikiem eGFP i 2?-O-metylowanymi oligomerami. (C) Analiza Northern blot RNA replikonu, eGFP i aktyny w komórkach Huh7 zawierających pełnogenomowy replikon H77c genotypu 1a i transfekowano eGFP-122 i 122-2?OMe. [0009] Fig. 3A-3C. Przewidywane miejsce wiążące miR-122 w rejonie niekodującym 5? HCV jest konieczne do utrzymania wirusowego RNA ze względu na bezpośrednie oddziaływanie z miR-122 długości (A) Lokalizacja RNA nukleotydów niekodującym H77c. została rejonie mutacji Mutacja stanowiąca wprowadzona 3? wprowadzonej (m3?) w a do pełnej substytucję regionie mutacje seed 4 w stanowiące substytucję 4 nukleotydów, 2 nukleotydów lub 1 nukleotydu wprowadzono w regionie dopasowania do seed w niekodującym rejonie 5? (odpowiednio, m5?A, B i C). Zmutowane nukleotydy zostały objęte prostokątnymi ramkami. (B) RNA został zsyntetyzowany w wyniku transkrypcji in vitro i wprowadzony do komórek Huh7 poprzez elektroporację, a poziomy RNA replikonu wyznaczano techniką Northern blotting po 5 dniach. Jako kontrolę przedstawiono wybarwiony błękitem metylenowym rybosomalny RNA. (C) Komórki Huh7 transfekowano syntetycznymi formami dwuniciowymi odpowiadającymi miR-122 typu dzikiego 5 (122wt) lub miR-122 z mutacją 1 nukleotydu w regionie seed komplementarną z mutacją m5?C w regionie dopasowania do seed (122mC), i o przeciwległej nici formy dwuniciowej opartej na prekursorowej strukturze spinki do włosów miR-122. Formy dwuniciowe wprowadzano do komórek Huh7 na jeden dzień przed elektroporacją cząsteczkami RNA H77c typu dzikiego lub cząsteczkami RNA z mutacją m5?C, i ponownie 1 i 3 dni po elektroporacji. Całkowite RNA zbierano 5 dni po elektroporacji i poziom RNA replikonu i aktyny wyznaczano techniką Northem blotting. [0010] Fig. 4. Mutacja w miejscu wiążącym miR-122 nie wpływa na translację mRNA HCV. Mutację m5?C wprowadzono do mutanta H77c, u którego nie zachodzi replikacja, AAG-H77, zawierającego zmianę aminokwasów z GDD na AAG w pozycjach 2737 do 2739 w wirusowej polimerazie NS5B (23). Lizaty zbierano 20 godzin po transfekcji RNA replikonu a ekspresję białka rdzeniowego HCV i aktyny wyznaczano techniką Western blotting. [0011] Fig. S3A i B. Dodanie syntetycznego dupleksu miR-122 do komórek replikonu NNeo/C-5B prowadziło do zwiększenia ilości replikonu RNA. Wskazane plazmidy niosące wskaźnik eGFP i typu dzikiego (122wt) lub zmutowane (122mC) dupleksy (formy dwuniciowe) miR-122 wprowadzano do komórek transfekując je z użyciem lipofektaminy 2000. Całkowite OPIS SZCZEGÓLNYCH POSTACI REALIZACJI WYNALAZKU [0012] Przedmiotem wynalazku są sposoby i kompozycje do zmniejszania ilości genomu wirusowego w komórce docelowej. W sposobach według wynalazku aktywność miRNA jest hamowana w sposób wystarczający do zmniejszenia ilości genomu wirusowego 6 w określonej komórce np. przez wprowadzenie środka hamującego miRNA w żądanej komórce. Przedmiotem wynalazku są również kompozycje farmaceutyczne, zestawy i układy do zastosowania w realizacji sposobów według wynalazku. Wynalazek może być zastosowany w wielu różnych dziedzinach obejmujących leczenie pacjentów cierpiących na stany chorobowe, które związane są z zakażaniem wirusowym, np. stanu chorobowego, który związany jest z infekcją HCV. [0013] Zanim przedmiot wynalazku zostanie opisany bardziej szczegółowo, konieczne jest wskazanie, że wynalazek jest zdefiniowany przez zastrzeżenia i nie jest ograniczony do żadnego szczególnego rozwiązania. Należy również wskazać, że terminologia zastosowana tutaj ma na celu jedynie opisanie poszczególnych wynalazku, rozwiązań, ponieważ lecz nie został ma on ograniczać ograniczony zakresu jedynie zastrzeżeniami. [0014] Gdy podany jest zakres wartości, należy rozumieć, że wynalazek obejmuje każdą z wartości znajdujących się w tym zakresie do dziesiętnych części jednostki dolnej granicy, jeśli treść nie wskazuje inaczej, pomiędzy górną a dolną granicą tego zakresu, jak również wszystkie inne wartości wskazane lub pośrednie w określonym zakresie. Górne i dolne granice tych mniejszych zakresów mogą niezależnie być objęte mniejszymi zakresami i są również objęte zakresem wynalazku, stanowiąc przedmiot wykluczonej granicy w względem określonym dowolnej, zakresie. szczegółowo Gdy określony zakres obejmuje jedną lub obie granice, zakresy wykluczające dowolną lub obie te granice również objęte są zakresem wynalazku. [0015] Sposoby przedstawione tutaj mogą być realizowane w 7 dowolnej kolejności, która jest logicznie możliwa, jak i w określonej tu kolejności. [0016] Jeśli nie zdefiniowano inaczej, wszystkie techniczne i naukowe terminy stosowane tutaj mają takie samo znaczenie jakie jest wiedzy z ogólnie dziedziny zrozumiałe do której dla specjalisty należy wynalazek. o typowej Mimo, że dowolne sposoby i materiały podobne lub równoważne do tych opisanych tutaj również mogą być stosowane w praktyce lub badaniu przedmiotowego wynalazku, korzystne są sposoby i materiału opisane tutaj. [0017] Należy podkreślić, że formy pojedyncze stosowane tutaj i w załączonych zastrzeżeniach obejmują też formy mnogie, jeśli treść nie wskazuje inaczej. Ponadto należy podkreślić, że zastrzeżenia mogą być opracowane tak aby wykluczały wszelkie elementy opcjonalne. Jako takie, twierdzenie to ma służyć jako poprzednia podstawa do zastosowania takiej wyłączającej terminologii jak ?tylko? ?jedynie? i tym podobne w połączeniu z wymienianiem elementów zastrzeżenia lub zastosowanie ograniczenia przez ?negację?. [0018] Cytowane tu publikacje przedstawiono wyłącznie ze względu na ujawnienie mające miejsce przed datą zgłoszenia wynalazku. Żaden z cytowanych tutaj dokumentów nie powinien być interpretowany jako przyznanie, że wynalazek nie jest uprawniony do takiej wynalazku. Ponadto, publikacji daty poprzedzającej publikacji, mogą zgłoszenie różnić się od rzeczywistych dat publikacji, które powinny być niezależnie potwierdzone. [0019] Jak przedstawiono powyżej, przedmiotem wynalazku są sposoby i kompozycje do zmniejszania ilości wirusowego genomu w określonej komórce genomu. Sposoby według wynalazku zostały 8 opisane bardziej szczegółowo na początku, a następnie zamieszczono przegląd różnych reprezentatywnych zastosowań, w których wynalazek ma zastosowanie, jak również zestawy, które mają stosowania w realizacji przedmiotu wynalazku. SPOSOBY [0020] Jak wskazano powyżej, ujawnione zostały sposoby zmniejszenia ilości genomu wirusa w komórce docelowej, gdzie komórka docelowa może oznaczać komórki w warunkach in vitro i in vivo. Termin "zmniejszenie ilości" oznacza, że poziom lub ilość docelowego genomu wirusa w określonej komórce jest zmniejszona co najmniej 2-krotnie, zwykle co najmniej około 5-krotnie, krotnie, np. 10-krotnie, 100-krotnie kontrolnej, czyli lub 15-krotnie, więcej, identycznej w 20-krotnie, porównaniu komórki do 50- komórki docelowej nie traktowanej zgodnie z przedmiotowym sposobem. [0021] W realizacji sposobów według wynalazku, skuteczną ilość środka hamującego miRNA (mikroRNA) wprowadza się do komórki docelowej, przy czym w celu wprowadzenia środka do komórki docelowej może być wykorzystany każdy odpowiedni protokół. Środek hamujący miRNA jest czynnikiem, który hamuje aktywność miRNA w określonej komórce docelowej. Docelowy miRNA jest miRNA, którego obecność jest związana z replikacją genomu wirusowego w komórce i jego ilością. Jak wiadomo, miRNA są to jednoniciowe cząsteczki RNA o długości w zakresie od około 20 do około 25 nukleotydów, na przykład od około 21 do około 24 nukleotydów, np. 22 lub 23 nukleotydów. Docelowe cząsteczki miRNA komplementarne genomu wirusa. z mogą być regionem Jeśli w tej pełni samej cząsteczki lub jedynie długości te nie co są częściowo miRNA w z pełni 9 komplementarne, miRNA i odpowiadający jej docelowy genom są przynajmniej rozbieżnych zasadniczo zasad komplementarne, obecnych na całej tak, że długości ilość miRNA, (w zakresie od około 20 do około 25 nukleotydów) nie przekracza około 8 nukleotydów a w pewnych rozwiązaniach nie może przekraczać 6 lub 5 nukleotydów, np. 4 nukleotydów. [0022] Środek hamujący miRNA oznacza środek, który hamuje aktywność docelowego miRNA. Środek hamujący może hamować aktywność miRNA poprzez wiele różnych mechanizmów. Środek hamujący stosowany według wynalazku to środek, który wiąże się z docelowym miRNA w ten sposób hamując jego aktywność. Środkami hamującym miRNA stosowane oligonukleotydy antysensowe, oligonukleotydy antysensowe według takie wynalazku jak są selektywne przedstawione w części doświadczalnej poniżej, i tym podobne. Inne środki obejmują między innymi: Naturalnie występujące lub syntetyczne małocząsteczkowe związki obejmujące liczne klasy chemiczne, ale zazwyczaj są małocząsteczkowe to cząsteczki związki organiczne, organiczne o masie korzystnie cząsteczkowej większej niż 50 i mniejszej niż 2500 daltonów. Środki, które mogą być stosowane zawierają grupy funkcyjne konieczne do oddziaływań strukturalnych z białkami, szczególnie tworzące wiązania wodorowe, i typowo obejmują co najmniej jedną grupę aminową, karbonylową, hydroksylową lub karboksylową, korzystnie co najmniej dwie z wymienionych chemicznych grup funkcyjnych. zawierają Środki, cykliczne, heterocykliczne które mogą złożone struktury być z i/lub stosowane atomów węgla aromatyczne często lub lub poliaromatyczne struktury podstawione przynajmniej jedną z powyższej wymienionych grup funkcyjnych. Rozważane są również 10 środki będące biocząsteczkami w tym peptydy, węglowodany, kwasy tłuszczowe, steroidy, puryny, pirymidyny, ich pochodne, analogi strukturalne lub mogą być ich identyfikowane kombinacje. między Cząsteczki takie innymi, wykorzystując odpowiednie protokoły przeszukiwania. [0023] Również przedmiotem zainteresowania są środki RNAi. Środek RNAi może oddziaływać na cząsteczkę prekursorową mikroRNA, znaną jako cząsteczka pre-mikroRNA. Środek do RNAi oznacza środek, który moduluje ekspresję mikroRNA poprzez mechanizm interferencji (wyciszania) RNA. Środkami RNAi mogą być małe cząsteczki kwasu rybonukleinowego (określane tu jako środki wyciszające kwasy oligorybonukleotydy, dwuniciowych, np. hybrydyzujące który ze przyjmuje strukturę które formę rybonukleinowy, który nukleotydów, typowo nukleotydów, gdzie nukleotydów. Jeżeli złożoną z hybrydyzujących d-siRNA, 60/377 jak 704, którego spinki do przekracza nie środek włosów nie różnych ze sobą, we około 75 70 dwuniciową rybonukleinowych złożonym jest 100 około strukturą np. wspólnie ujawnienie długości kwasów kwas około przekracza jest tworząc oznacza długości przekracza RNA strukturach oligorybonukleotyd, Oligorybonukleotyd długość opisano w czyli oligorybonukleotydy pojedynczy małej nie dwóch obecne odrębne lub dwuniciową. a są dwa sobą rybonukleinowe), siRNA (np. zgłoszeniu włączone tutaj nr przez odniesienie), długość struktury dwuniciowej zwykle zawiera się od około 15 do 30 bp, zwykle od około 15 do 29 bp, przy czym długości od około 20 do 29 bp, np. 21 bp, 22 bp, są szczególnie interesujące. Gdy środek RNA jest strukturą dwuniciową utworzoną przez jeden kwas rybonukleinowy, który 11 przyjmuje strukturę spinki do włosów, czyli shRNA, długość hybrydyzującej części w strukturze spinki do włosów jest zwykle taka sama, jak podana powyżej dla środka typu siRNA lub jest o 4-8 nukleotydów dłuższa. Masa cząsteczkowa środków RNAi wynosi typowo od około 5 000 daltonów do około 35 000 daltonów, lub co najmniej około 10 000 daltonów i mniej niż 27 500 daltonów, często mniej niż około 25 000 daltonów. [0024] Zamiast środka do RNAi będącego wyciszającym kwasem rybonukleinowym, np. siRNA lub shRNA, jak opisano powyżej, środek do RNAi może kodować wyciszający kwas rybonukleinowy, np. shRNA, jak opisano powyżej. Innymi słowy, środek do RNAi może stanowić matrycę do transkrypcji dla wyciszającego kwasu rybonukleinowego. Matrycą do transkrypcji jest zazwyczaj DNA, który koduje wyciszający kwas rybonukleinowy. DNA może być obecny w wektorze, przy czym znanych jest wiele różnych wektorów, np. wektor plazmidowy, wektor wirusowy, itp. [0025] Jak wskazano powyżej, środek hamujący miRNA można wprowadzić do komórki(ek) docelowej (ych) stosując dowolny odpowiedni protokół, przy czym zastosowany protokół będzie zależał od tego, czy komórki docelowe są obecne in vitro czy in vivo. [0026] W przypadku, gdy komórki docelowe są obecne in vivo, środek do miRNA może być podawany gospodarzowi za pomocą dowolnego dogodnego protokołu. Zastosowanym protokołem jest zazwyczaj czym protokół znanych jest wprowadzania wiele różnych kwasów nukleinowych, odpowiednich przy protokołów. Poniżej przedstawiono przegląd reprezentatywnych protokołów podawania kwasu nukleinowego, które mogą być zastosowane. Kwasy nukleinowe mogą być wprowadzane do tkanek i komórek gospodarza dowolną z wielu różnych dróg, w tym przez 12 zakażenie wirusem, mikroiniekcję lub fuzję pęcherzyków. Może być również zastosowane wstrzyknięcie przezskórne strumieniem roztworu pod wysokim ciśnieniem do podawania domięśniowego, jak opisano przez Furtha i wsp. (1992), Anal Biochem 205:365368. Kwasy nukleinowe mogą być naniesione na mikrocząstki złota i dostarczane śródskórnie za pośrednictwem urządzenia do bombardowania cząstkami, lub "strzelbą genową", jak opisano w literaturze (zob. na przykład, Tang i wsp. (1992), Nature 356:152-154), pokrywane DNA, gdzie którymi opisano następnie mikropociski bombarduje ze się złota komórki skóry. Do wprowadzania kwasów nukleinowych do komórki mogą być wykorzystywane wektory ekspresyjne. Wektory takie mają zwykle dogodne miejsca restrykcyjne zlokalizowane w pobliżu sekwencji promotora aby zapewnić wprowadzenie sekwencji kwasu nukleinowego. Kasety transkrypcyjne mogą być przygotowane tak aby obejmowały region inicjacji transkrypcji, docelowy gen lub jego fragment oraz region terminacji transkrypcji. Kasety transkrypcyjne mogą być wprowadzane do różnych wektorów, np. plazmidu, retrowirusów, np. lentiwirusa, adenowirusa i tym podobnych, przy czym wektory są zdolne do utrzymania się w komórkach czasowo lub stabilnie, zwykle przez okres co najmniej jednego dnia, częściej przez okres co najmniej kilku dni do kilku tygodni. [0027] Na przykład, bezpośrednio, środek wstrzykiwany hamujący do może organizmu być podawany gospodarza zawierającego gen docelowy. Środek może być wprowadzony do komórki bezpośrednio (np. wewnątrzkomórkowo) lub wprowadzany zewnątrzkomórkowo do jamy, przestrzeni międzykomórkowej, do układu krążenia organizmu, wprowadzony doustnie, itd. Metody wprowadzania doustnego obejmują bezpośrednie mieszanie RNA z 13 żywnością dla organizmu. Fizyczne metody wprowadzania kwasów nukleinowych obejmują bezpośrednie wstrzyknięcie roztworu RNA do komórki lub wstrzyknięcie do przestrzeni zewnątrzkomórkowej organizmu. Środek może być wprowadzony w ilości, która pozwala na dostarczenie co najmniej jednej kopii na komórkę. Wyższe dawki środka (np. co najmniej 5, 10, 100, 500 lub 1000 kopii na komórkę) mogą zapewnić skuteczniejsze hamowanie, w określonych zastosowaniach mogą być odpowiednie również niższe dawki. [0028] W protokół Jeżeli pewnych postaciach hydrodynamicznego środkiem jest hydrodynamicznego wynalazku, podawania kwas podawania można kwasu stosować nukleinowego. rybonukleinowy, kwasu protokół rybonukleinowego szczegółowo opisany poniżej, jest przedmiotem szczególnego zainteresowania. Jeżeli środkiem jest kwas deoksyrybonukleinowy, protokoły hydrodynamicznego podawania kwasu deoksyrybonukleinowego zostały opisane w pracach Chang i wsp., J. Virol. (2001) 75:, Liu i wsp, Gene Ther.. (1999) 6:1258-1266; Wolff i wsp, Nauka (1990) 247:.. 1465/68; Zhang i wsp, Hum. Gene Ther. (1999) 10:1735-1737: i Zhang i wsp, Gene Ther. (1999) 7: 1344/49, są przedmiotem zainteresowania. [0029] Dodatkowe protokoły podawania kwasu nukleinowego obejmują między innymi: te opisane w patentach US 5 985 847 i US 5 922 687; WO/11092; w pracach Acsadi i wsp., New Biol. (1991) 3:71-81; Hickman i wsp, Hum. Gen. Ther. (1994) 5:14771483; i Wolff i wsp, Science (1990) 247:. 1465-1468, itp. [0030] W zależności od właściwości środka hamującego, substancja(-e) czynna (-e) mogą być podawane gospodarzowi w dowolny dogodny zmniejszenia sposób ilości lub zdolny do obciążenia wywołania przez pożądanego docelowy genom 14 wirusa w komórce wprowadzony do terapeutycznego. mogą być docelowej. różnych W z nośnikami w środek środki farmaceutyczne odpowiednimi lub więc preparatów szczególności, formułowane połączenie Tak i podawania według wynalazku kompozycje mogą być do farmaceutycznie rozcieńczalnikami może poprzez dopuszczalnymi być formułowane w preparaty w postaci stałej, pół-stałej, ciekłej lub gazowej, np. obejmujące tabletki, kapsułki, proszki, granulki, maści, roztwory, czopki, zastrzyki, formy do inhalacji i aerozole. Jako takie podawanie środków może być prowadzone różnymi sposobami, w tym poprzez podawanie doustne, podpoliczkowe, doodbytnicze, pozajelitowe, dootrzewnowe, śródskórne, przezskórne, dotchawicze itp. [0031] W farmaceutycznych postaciach dawkowania, środki mogą być podawane same lub w odpowiednim połączeniu, jak również w połączeniu Dalej z innymi opisane związkami sposoby i farmaceutycznie substancje aktywnymi. pomocnicze stanowią jedynie przykłady i w żaden sposób nie ograniczają zakresu wynalazku. [0032] W preparatach doustnych, środki mogą być stosowane same lub w połączeniu z odpowiednimi dodatkami do wytwarzania tabletek, proszków, granulek lub kapsułek, na przykład, z typowymi dodatkami, takimi jak laktoza, mannitol, skrobia kukurydziana lub skrobia ziemniaczana, ze środkami wiążącymi, takimi jak celuloza krystaliczna, pochodne celulozy, guma arabska, skrobia rozsądzającymi, ziemniaczana środkami kukurydziana takimi lub sól poślizgowymi, jak lub skrobia żelatyna, ze kukurydziana, środkami skrobia sodowa karboksymetylocelulozy, takimi jak talk lub ze stearynian magnezu, a w razie potrzeby, z rozcieńczalnikami, środkami 15 buforującymi, nawilżającymi, środkami konserwującymi i środkami aromatyzującymi (smakowymi). [0033] Środki mogą być formułowane w preparaty do wstrzykiwań przez rozpuszczenie, zawieszenie lub tworzenie emulsji w wodnych lub niewodnych rozpuszczalnikach, takich jak oleje roślinne lub inne podobne oleje, syntetyczne glicerydy kwasów alifatycznych, estry wyższych kwasów alifatycznych lub glikol propylenowy, dodatkami, środki i jeśli takimi jak zawieszające, jest to wskazane, solubilizatory, emulgatory, z tradycyjnymi środki izotoniczne, stabilizatory i środki konserwujące. [0034] Środki mogą być stosowane w aerozolu do podawania przez inhalację. formułowane w Związki aerozol z według wynalazku gazami pędnymi mogą być takimi jak dichlorodifluorometan, propan, azot i tym podobne. [0035] Ponadto, środki mogą być w postaci czopków uzyskanych przez zmieszanie z różnymi podłożami, takimi jak podłoża emulgujące lub podłoża rozpuszczalne w wodzie. Związki według wynalazku można podawać doodbytniczo w postaci czopków. Czopki mogą zawierać nośniki takie jak: masło kakaowe, woski glikole polietylenowe Carbowax i glikole polietylenowe, które topią się w temperaturze ciała, ale są w stanie stałym w temperaturze pokojowej. [0036] Jednostkowe postacie dawkowania do podawania doustnego lub doodbytniczego, takie jak syropy, eliksiry i zawiesiny mogą być uzyskane, tak że każda jednostka dawkowania, na przykład, łyżeczka, łyżka, tabletka lub czopek, zawiera wcześniej określoną ilość kompozycji zawierającej jeden lub więcej inhibitorów. Podobnie jednostkowe postacie dawkowania do wstrzykiwań lub podawania dożylnego mogą zawierać 16 inhibitor(y) wodzie, w soli kompozycji w postaci fizjologicznej lub roztworu innym w sterylnej farmaceutycznie dopuszczalnym nośniku. [0037] Określenie "jednostkowa postać dawkowania," jak tutaj stosowano, odnosi się do fizycznie odrębnych jednostek do wykorzystania jako dawki jednostkowe u ludzi i zwierząt, przy czym każda jednostka zawiera określoną ilość związków według wynalazku obliczoną tak aby związki aktywne były obecne w ilości wystarczającej do wytworzenia pożądanego efektu, w połączeniu z farmaceutycznie dopuszczalnym rozcieńczalnikiem, nośnikiem lub zaróbką. Zestawienie nowych jednostkowych postaci dawkowania według wynalazku zależy od konkretnego stosowanego związku i tego jaki efekt ma być osiągnięty, a także od farmakodynamiki związanej z każdym związkiem w organizmie gospodarza. [0038] Farmaceutycznie dopuszczalne substancje pomocnicze, takie jak zaróbki, adjuwanty, nośniki lub rozcieńczalniki, są łatwo dostępne. Ponadto farmaceutycznie dopuszczalne substancje pomocnicze, takie jak środki dostosowujące pH i środki buforujące, środki regulujące toniczność, stabilizatory, środki zwilżające itp. są łatwo dostępne. [0039] Specjaliści w tej dziedzinie łatwo zauważą, że dawki mogą się różnić w zależności od określonego związku, rodzaju stosowanej zaróbki do podawania, i tym podobnych. Korzystne dawki dla danego związku specjalista w tej dziedzinie łatwo określi, stosując różne środki. [0040] Wprowadzenie skutecznej ilości środka do RNAi do komórek ssaków, jak opisano powyżej prowadzi do modulacji ekspresji docelowego genu (ów) np. obniżenia ekspresji docelowego genu(ów), jak opisano powyżej. poziomu 17 [0041] Opisane powyżej sposoby są odpowiednie do stosowania w dowolnych komórkach ssaków, przy czym reprezentatywnymi komórkami ssaków interesującymi według wynalazku są między innymi komórki: zwierząt nieparzystokopytnych, np. parzystokopytnych bydła, kóz, świń, lub owiec, itp., gryzoni, np. chomików, myszy, szczurów, itp., zajęczaków, np. królików, naczelnych, np. małp, pawianów, ludzi, i tym podobnych. [0042] Kompozycje mogą być korzystnie połączone i/lub stosowane w połączeniu lub naprzemiennie z innymi środkami przeciwwirusowymi, które profilaktycznymi i Kompozycje także mogą są różnią środkami się być od terapeutycznymi omawianych korzystnie lub związków. połączone i/ lub stosowane w połączeniu ze środkami do leczenia stanów często związanych obecne z zakażeniami wirusowymi, które są wrażliwe na związki, takie immunosupresyjne. W jak środki przeciwko niektórych HCV postaciach lub leki wynalazku, podawanie w połączeniu z przedmiotowymi kompozycjami zwiększa skuteczność takich środków. W związku z powyższym, związki według wynalazku, w połączeniu lub podawane w połączeniu z innymi środkami przeciwwirusowymi, mogą być stosowane w pewnych postaciach wynalazku w dawkach, które są mniejsze od spodziewanych, gdy środki te są stosowane same lub mniejsze niż ilości obliczone w przypadku leczenia skojarzonego. [0043] Przykładowe możliwości terapii wirusowego zapalenia wątroby typu C (HCV) obejmują podawanie interferonów, np. interferonu aifacon-1. alfa-2b, Rzadsze interferonu dawkowanie alfa-2a interferonu i interferonu można osiągnąć stosując pegylowany interferon (interferon z dołączoną resztą glikolu polietylenowego, który znacząco poprawia jego 18 farmakokinetykę). Leczenie skojarzone z interferonem alfa-2b (pegylowanym i niepegylowanym) i rybawaryną również okazało się skuteczne u niektórych populacji pacjentów. Inne, obecnie opracowane środki obejmują inhibitory replikacji RNA (np. serie VP50406 z ViroPharma), środki antysensowe, szczepionki terapeutyczne, inhibitory proteazy, inhibitory helikazy i terapie przeciwciałami (monoklonalnymi i poliklonalnymi). [0044] Związki i kompozycje według wynalazku można również stosować ze środkami, które wspomagają system odpornościowy organizmu, w tymostymuliną, tym cyklofosfamidem witaminami i w małej suplementami dawce, diety (np. przeciwutleniaczami, w tym witaminą A, C, E, beta-karotenem, cynkiem, selenem, glutationem, koenzymem Q-10 i wyciągiem z jeżówki), i szczepionkami, np. kompleksem immunostymulującym (ISCOM), który składa się z preparatu szczepionki, obejmującego multimeryczną prezentację antygenu i adiuwant. [0045] Opisane powyżej sposoby znajdują zastosowanie w wielu różnych dziedzinach, z których reprezentatywne rodzaje zostały opisane bardziej szczegółowo poniżej. ZASTOSOWANIE [0046] Przedmiotowe sposoby znajdują zastosowanie w leczeniu wielu różnych stanów, w których pożądane jest zmniejszenie ilości docelowego genomu wirusowego w docelowej komórce lub u gospodarza zawierającego wynalazku, przedmiotowe ten genom. sposoby W wielu znajdują postaciach zastosowanie w leczeniu gospodarza cierpiącego na stan chorobowy związany z wirusem. Leczenie złagodzenie oznacza, objawów że związanych osiąga z się chorobą, gospodarza, przy czym termin złagodzenie co najmniej dotykającą jest stosowany w 19 szerokim sensie odnosząc się do co najmniej zmniejszenia wielkości parametru, np. objawu związanego z leczonym stanem. W związku z tym leczenie obejmuje również sytuacje, w których stan patologiczny, a przynajmniej objawy z nim związane, są całkowicie zahamowane, np. zapobiega się wystąpieniu objawu, lub dany objaw przestaje występować, np. kończy się i gospodarz nie cierpi już z powodu stanu lub przynajmniej z powodu objawów charakterystycznych dla tego stanu. [0047] Przedmiotowe sposoby są przydatne w leczeniu wielu gospodarzy. Ogólnie, takimi gospodarzami są "ssaki" lub "ssacze?, przy czym termin ten jest stosowany szeroko aby opisać organizmy, które należą do gromady Mammalia, w tym rząd mięsożerne (np. psy i koty), gryzonie (np. myszy, świnki morskie oraz szczury) i naczelne (np. ludzie, szympansy i małpy). W wielu realizacjach, gospodarzem będzie człowiek. [0048] Jak wskazano powyżej, sposoby mogą być zastosowane do dowolnego komórce wirusowego koreluje genomu, się z którego ilością ilość miRNA w w określonej tej komórce. W pewnych postaciach wynalazku, genom wirusowy stanowi genom wirusa mającego genom RNA, przy czym wirus może być z rodziny Flaviviridae, np. hepacivirus, taki jak wirus zapalenia wątroby typu C, np., Wirus zapalenia wątroby typu C (izolat 1), Wirus zapalenia zapalenia wątroby wątroby typu C typu (izolat C (izolat EC1), BK), Wirus Wirus zapalenia wątroby typu C (izolat EC10), Wirus zapalenia wątroby typu C (izolat HC-J2), Wirus zapalenia wątroby typu C (izolat HCJ5), Wirus zapalenia wątroby typu C (izolat HC-J6), Wirus zapalenia wątroby typu C (izolat HC-J7), Wirus zapalenia wątroby typu C (izolat HC-J8), Wirus zapalenia wątroby typu C (izolat HC-JT), Wirus zapalenia wątroby typu C (izolat 20 HCT18), Wirus zapalenia wątroby typu C (izolat HCT27), Wirus zapalenia wątroby typu C (izolat HCV-476), Wirus zapalenia wątroby typu C (izolat HCV-KF), Wirus zapalenia wątroby typu C (izolat Hunan), Wirus zapalenia wątroby typu C (izolat japoński), Wirus zapalenia wątroby typu C (izolat taiwański), Wirus zapalenia wątroby typu C (izolat TH), Wirus zapalenia wątroby typu C izolat H, Wirus zapalenia wątroby typu C typ 1, Wirus zapalenia wątroby typu C typ 10, Wirus zapalenia wątroby typu C typ 2, Wirus zapalenia wątroby typu C typ 3, Wirus zapalenia wątroby typu C typ 4, Wirus zapalenia wątroby typu C typ 5, Wirus zapalenia wątroby typu C typ 6, Wirus zapalenia wątroby typu C typ 7, Wirus zapalenia wątroby typu C typ 8, itp. [0049] W pewnych wynalazek jest reprezentatywnych stosowany w postaciach sposobach leczenia wynalazku, gospodarza cierpiącego na stan chorobowy związany z zakażeniem HCV, np. wirus zapalenia (NANBH). W hamującego wątroby tych nie będący realizacjach, miR122, takiego jak typem A skuteczną ani ilość antysensowy typem B środka oligo jak przykładowo opisano dalej, podaje się gospodarzowi, aby ilość HCV genomu w komórkach gospodarza, szczególnie w komórkach wątroby była zmniejszona, jak opisano powyżej. KOMPOZYCJE FARMACEUTYCZNE [0050] Przedmiotem wynalazku są również kompozycje farmaceutyczne zawierające związki hamujące miRNA zastosowane w przedmiotowych postaci sposobach. farmaceutycznie Odpowiednio, dopuszczalnych związki, soli, np. mogą w być przygotowywane do podawania doustnego lub pozajelitowego do stosowania w tych sposobach, jak opisano powyżej. 21 [0051] Przykładowo, konwencjonalnymi związki mogą farmaceutycznymi być nośnikami zmieszane i z substancjami pomocniczymi (np. zaróbkami) i stosowane w postaci wodnych roztworów, tabletek, kapsułek, eliksirów, zawiesin, syropów, opłatków i tym podobnych. Takie kompozycje farmaceutyczne zawierają w pewnych postaciach wynalazku, od około 0,1 do około 90% wagowych substancji czynnej, a bardziej ogólnie od około 1 do Farmaceutyczne około 30% kompozycje wagowych mogą substancji zawierać typowe czynnej. nośniki i substancje pomocnicze, takie jak skrobia kukurydziana lub żelatyna, laktoza, mikrokrystaliczna, dekstroza, kaolin, sacharoza, mannitol, celuloza difosforan wapnia, chlorek sodu i kwas alginowy. Środki rozsadzające powszechnie stosowane w kroskarmelozę, preparatach celulozę według wynalazku obejmują mikrokrystaliczną, skrobię kukurydzianą, sól sodową glikolanu skrobi i kwas alginowy. [0052] Kompozycje ciekłe zwykle składają się z zawiesiny lub roztworu związku lub jego farmaceutycznie dopuszczalnej soli w odpowiednim(-ch) ciekłym(-ch) nośniku(-ach), takim(-ch) jak na przykład, etanol, gliceryna, sorbitol, rozpuszczalniku niewodnym, taki jak glikol polietylenowy, oleje lub w wodzie, zawierając środek zawieszający, środek konserwujący, środek powierzchniowo czynny, środek zwilżający, środek aromatyzujący (smakowy) lub środek barwiący. Alternatywnie, postaci płynne mogą być wytwarzane z odtwarzalnego proszku. [0053] Na przykład, proszek zawierający substancję czynną, środek zawieszający, sacharozę i słodzik może być rozpuszczony w wodzie do wytworzenia zawiesiny a syrop może być przygotowany z proszku zawierającego składnik aktywny, sacharozę i słodzik. 22 [0054] Kompozycję w postaci tabletki można wytwarzać przy użyciu wszelkich rutynowo stosowanych Przykłady skrobię, odpowiednich takich do wytwarzania nośników laktozę, nośników sacharozę, obejmują celulozę farmaceutycznych kompozycji stałych. stearynian magnezu, mikrokrystaliczną i środki wiążące, na przykład, poliwinylopirolidon. Tabletka może również zawierać powłokę określonego koloru lub kolor może być wprowadzony do nośnika(ów). może być przygotowany w postaci Ponadto, związek czynny formy dawkowania o kontrolowanym uwalnianiu jako tabletka zawierająca podłoże hydrofilowe lub hydrofobowe. [0055] Kompozycja w postaci kapsułki może być wytworzona z użyciem rutynowych procedur kapsułkowania, na przykład przez wprowadzenie substancji czynnej i substancji pomocniczych do twardej kapsułki żelatynowej. Alternatywnie, pół-stała macierz substancji czynnej i glikolu polietylenowego o dużej masie cząsteczkowej może być przygotowana i wprowadzona do twardej kapsułki żelatynowej albo roztwór substancji czynnej w glikolu polietylenowym lub zawiesina w oleju jadalnym, na przykład w ciekłej parafinie lub frakcjonowanym oleju kokosowym, mogą być przygotowane i wprowadzone do miękkiej kapsułki żelatynowej. [0056] Środki wiążące stosowane w tabletkach, które mogą być obecne obejmują gumę karboksymetylocelulozy, arabską, metylocelulozę, poli-winylopirolidon hydroksypropylometylocelulozę, sacharozę, celulozę. które Środki smarujące, mogą sól (Rovidone), skrobię być sodową i etylo- zastosowane obejmują stearynian magnezu lub stearyniany innych metali, kwas stearynowy, płyn krzemionkę koloidalną. silikonowy, talk, woski, oleje i 23 [0057] Środki smakowo-zapachowe takie jak mięta pieprzowa, olejek z golterii pełzającej, aromat wiśniowy i tym podobne, mogą być również stosowane. Dodatkowo aby uzyskać bardziej atrakcyjny wygląd lub do identyfikacji produktu, może być pożądane dodanie barwnika do postaci do dawkowania. [0058] Związki dopuszczalne według sole, pozajelitowego wynalazku które można są i ich aktywne przygotowywać w farmaceutycznie podczas formie podawania do podawania domięśniowego, dooponowego lub dożylnego. [0059] Typowa kompozycja podpajęczynówkowego roztworu będzie składnika arachidowym lub do podawania miała aktywnego oleju w domięśniowego postać oleju, sezamowym. lub zawiesiny na przykład, Typowa lub oleju kompozycja do podawania dożylnego lub podpajęczynówkowego będzie jałowym izotonicznym roztworem wodnym zawierającym, na przykład, składnik aktywny i dektrozę lub chlorek sodu lub mieszaninę dekstrozy i chlorku sodu. Inne przykłady obejmują mleczan Ringera do dekstrozą, roztwór preparat zastrzyków, Normosol-M Ringera do zawiera polietylenowy, mleczan i dekstrozę, zastrzyków i tym ko-rozpuszczalnik, środek chelatujący, etylenodiaminotetraoctowy pirosiarczyn Ringera sodu. i do zastrzyków Isolit E, podobne. na na Alternatywnie, acylowany Ewentualnie przykład, przykład, przeciwutleniacz, z na roztwór glikol kwas przykład, może być liofilizowany a następnie odtwarzany tuż przed podaniem z użyciem odpowiedniego rozpuszczalnika. [0060] Związki dopuszczalne według sole, wynalazku które są i ich aktywne farmaceutycznie przy podawaniu doodbytniczym można przygotowywać w postaci czopków. Typowy preparat czopków zwykle składa się z substancji czynnej ze 24 środkiem wiążącym i/lub środkiem smarującym, takim jak żelatyna lub masło kakaowe lub inny roślinny lub syntetyczny wosk lub tłuszcz o niskiej temperaturze topnienia. [0061] według Związki wynalazku i ich farmaceutycznie dopuszczalne sole, które są aktywne przy podawaniu miejscowym mogą być przygotowane jako kompozycje przezskórne lub układy do podawania przezskórnego ("plastry - patches"). Takie kompozycje obejmują na przykład, podłoże, zbiornik związku aktywnego, błonę kontrolującą, wykładzinę i klej kontaktowy. Takie plastry transdermalne mogą być wykorzystane w celu zapewnienia ciągłej lub nieciągłej infuzji związków według wynalazku w kontrolowanych ilościach. Budowa i zastosowanie plastrów transdermalnych farmaceutycznych są w celu dobrze dostarczania znane. Zobacz np. środków patent US 5023252, udzielony 11 czerwca 1991, włączony tu w całości przez odniesienie. Plastry takie mogą być wytworzone tak aby dostarczały środek farmaceutyczny w sposób ciągły, pulsacyjny lub na żądanie. [0062] Ewentualnie, kompozycja farmaceutyczna może zawierać inne farmaceutycznie bufory, środki środki dopuszczalne powierzchniowo modyfikujące lepkość, składniki, czynne, środki takie jak przeciwutleniacze, konserwujące i tym podobne. Każdy z tych składników jest dobrze znany. Zobacz na przykład patent US 5985310, którego ujawnienie jest tu stosowania w włączone przez odniesienie. [0063] Inne składniki odpowiednie do kompozycjach według wynalazku można znaleźć w Remington's Pharmaceutical Sciences, Mace Publishing Company, Philadelphia, Pennsylvania, wyd. 17. (1985). W jednej postaci wykonania, wodny roztwór cyklodekstryny zawiera ponadto 25 dekstrozę, np. około 5% dekstrozy. ZESTAWY [0064] Przedstawione są również odczynniki i ich zestawy do wykonywania jednego lub więcej z wyżej opisanych sposobów. Przedmiotowe odczynniki i ich zestawy mogą być bardzo różne. Zazwyczaj zestawy zawierają co najmniej środek hamujący miRNA, jak opisano powyżej. Zestawy mogą zawierać również farmaceutycznie dopuszczalne nośniki, które mogą być połączone lub przygotowane oddzielnie od środka hamującego miRNA w zestawie, np. w którym dwa składniki mogą być w tym samym lub oddzielnych pojemnikach. [0065] Oprócz powyżej wspomnianych składników, zestawy dodatkowo będą zawierać instrukcje do przeprowadzenia tych sposobów. Instrukcje te mogą być obecne w zestawach w różnych formach, z zestawie. których Jedną z przynajmniej form, w jedna których może być instrukcje obecna mogą w być dostarczone jest podanie informacji na odpowiednim nośniku lub podłożu, np. na papierze, na którym informacje zostały wydrukowane, stanowiąc opakowanie zestawu, lub osobną ulotkę, itp. Jeszcze inny sposób obejmuje nośnik do komputerowego odczytu, np. dyskietkę, płytę CD itp. na którym informacja została zapisana. Jeszcze innym rozwiązaniem jest skorzystanie ze strony internetowej, która zapewnia dostęp do informacji przez internet. Każdy dogodny sposób może być zastosowany w zestawach. UKŁADY [0066] Ponadto zastosowanie w wynalazek realizacji obejmuje układy, sposobów, jak które znajdują opisano powyżej. 26 Na przykład, układy do realizacji sposobów mogą obejmować jeden lub więcej preparatów farmaceutycznych, które obejmują środek hamujący dokumencie miRNA. Określenie "układ" się zestawu składników, odnosi do stosowane np. w środka czynnego, nośnika, itp. obecnych w jednej kompozycji lub jako osobne kompozycje, przeprowadzenia które sposobu. Na są łączone przykład, razem w oddzielnie celu uzyskane środek czynny i nośnik połączone razem i podane pacjentowi jednocześnie, według wynalazku, stanowią układ według wynalazku. [0067] Przedstawione dalej przykłady są jedynie ilustracją rozwiązań, nie stanowiąc ograniczenia. CZĘŚĆ DOŚWIADCZALNA I. Wyniki i dyskusja [0068] Aby rozpocząć poznawanie roli miR-122 w regulowaniu funkcjonowania mRNA, badano ekspresję miR-122 w próbkach RNA ekstrahowanych z tkanek wątroby oraz z linii komórkowych komórek wątroby. Fig. 1A przedstawia, że miR-122 mógł być wykrywany w wątrobie myszy i ludzi oraz w hodowlach linii komórkowych komórek wątroby Huh7, jednakże nie stwierdzono jego obecności w komórkach HeLa pochodzących z ludzkiego raka szyjki macicy, ani nawet w komórkach HepG2 pochodzących z wątroby ludzkiej (Fig. 1A). [0069] Wiadomo, że RNA wirusa zapalenia wątroby typu C (HCV), który niesie mutacje adaptacyjne, może ulegać replikacji w komórkach Huh7 lecz nie w komórkach HepG2, i twórcy chcieli zbadać czy obecność miR-122 w komórkach Huh7 z RNA HCV ulegającym replikacji było czymś więcej niż tylko czystym 27 zbiegiem okoliczności. W tym celu zbadano pozytywną nić RNA o długości 9 600 nukleotydów pod kątem ewentualnych miejsc wiążących miR-122, które spełniłyby wymagania konieczne do wystąpienia oddziaływania miRNA z docelowym RNA. Poszukiwano sekwencji w wirusowym doskonałym parowaniu mRNA, zasad która mogłaby według uczestniczyć Watsona i w Cricka, zawierającej od 2 do 8 nukleotydów, tj. ?sekwencji seed? w obrębie miR-122. obecność w wirusowych przewidywanych region Wykorzystując był miejsc tę rejonach wiążących zlokalizowany zasadę w stwierdziliśmy niekodujących miR-122 zmiennym (Fig. dwóch 1B). regionie Jeden wirusowego rejonu niekodującego 3? genotyp typu 1 (Fig. 1C). Mimo, że sekwencja ta była w nominalnie ?rejonie zmiennym?, badanie wszystkich sześciu genotypów HCV wykazało, że sekwencja dopasowana do seed sama była wysoko konserwowana (Tabela 1). Drugie przewidywane miejsce wiążące miR-122 znajduje się w rejonie niekodującym 5? i jest oddalone o jedynie 21 nukleotydów od końca 5? genomu wirusowego (Fig. 1C). Tutaj możliwa sekwencja dopasowania do seed była flankowana przez reszty adenozyny. Prowadzi to do dalszego parowania zasad z 1 nukleotydem w miRNA, który w większości przypadków stanowi reszta urydynowa, oddziaływania prowadząc docelowych do zwiększonej mikroRNA. specyficzności Możliwa domniemana sekwencja dopasowana do seed w obrębie miR-122 obejmująca flankujące konserwowana reszty wśród adenozyny wszystkich jest w znacznym genotypów stopniu wirusowych z wyjątkiem sekwencji dopasowanej do seed w genotypie 2, w której nie jest obecna zakotwiczająca adenozyna (Tabela 1). Tabela 1 28 Genotyp SEQ ID NO: 5?UTR 1a(01&02) UGAUGGGGGCGACACUCCAC UGAAGGUUGGGGUAACACUCCGGCC 1b(03&04) AUUGGGGGCGACACUCCACC UGAACGGGGAGCUAAACACUCCAGG 2(05&06) AAUAGGGGCGACACUCCGCC UAGAGCGGCACACACUAGGUACACUCCA 3(07&08) UACGAGGCGACACUCCACCA UGAGCUGGUAAGAUAACACUCCAUU 4(09&10) UAUGAGAGCAACACUCCACC UAGGCAGCUUAACACUCCGACCUUA 5(11&12) UAUUGGGGCGACACUCCACC UAGGCUGGGAGCUAAACACUCCAUA 6(13&14) AAUGGGGCGACACUCCACCA UAGACAGGGAGCAUAAAUAACACUCCA [0070] Przewidywane 3?UTR miejsca wiążące miR-122 w HCV są konserwowane we wszystkich genotypach. Sekwencję 5?UTR od nukleotydów 10-30 w genomie i sekwencję 3?UTR od kodonu stop do końca przewidywanego miejsca wiążącego, przedstawiono dla każdego z genotypów. Dopasowania seed wskazano wytłuszczoną czcionką. [0071] Aby określić czy miR-122 odgrywa funkcjonalną rolę w regulacji ekspresji genów HCV, twórcy określili czy akumulacja replikonowych cząsteczek RNA ulegałaby regulacji w wyniku dezaktywacji (Ikeda, (2002)). M. Yi, K. Komórki miR-122 w M. komórkach Li, S. Lemon, te prowadzą J. NNeo/C-5B Virol. konstytutywną 76, Huh7 2997 ekspresję dicistronowych wirusowych replikonów, w których wewnętrzne miejsce wejścia do rybosomu w HCV (IRES) ukierunkowuje syntezę produktu genu oporności na neomycynę, a IRES wirusa zapalenia serca, mózgu i rdzenia ukierunkowuje syntezę białek strukturalnych i niestrukturalnych szczepu N1b HCV (Fig. 2A, górny wykres). W celu dezaktywacji miR-122 w tej linii komórkowej, komórki NNeo/C-5B transfekowano 2?-O-metylowanym oligonukleotydem RNA (122-2?OMe), o długości 31 nukleotydów, 29 o pełnej komplementarności komplementarne z 2?O-metylowane miR-122; nukleotydy wykazano, RNA że sekwestrują miRNA (Hutvagner, i wsp., PLoS Biol. 2, E98 (2004); Meister, i wsp., RNA 10, 544 (2004)). Jako kontrolę funkcjonalnej dezaktywacji miR-122 twórcy monitorowali ekspresję cząsteczek mRNA białka wskaźnikowego eGFP (eGFP-122), które zawierały sekwencje komplementarne z miR-122 w swoich rejonach niekodujących 3?. Ze względu na jego pełną komplementarność, miR-122 powinien funkcjonować tak jak siRNA względem tych cząsteczek docelowych i prowadzić do ich rozkładu nukleolitycznego. Faktycznie, niewielki pełnej długości RNA eGFP-122 był widoczny w komórkach transfekowanych plazmidem kodującym eGFP-122 (Fig. 2A, ścieżka 3), mimo, że podobny RNA, który zawierał miejsca komplementarne ze specyficznym dla mózgu miR-124 ulegał ekspresji na znacznym poziomie (Fig. 2A, ścieżka 2). Po transfekcji z użyciem 122-2?OMe, ilość RNA eGFP-122 dramatycznie zwiększyła się (Fig. 2A, ścieżka 4), podczas gdy randomizowana odmiana tego oligomeru (Rand-2?OMe, ścieżka 5) lub oligomer komplementarny z miRNA let-7a (let7-2?OMe) nie wykazywał żadnego wpływu (Fig. 2A, ścieżka 6). Oligomer o 23 merach komplementarny z miR-122 prowadził do tego samego efektu co 31-mer. [0072] Niespodziewanie, poziom RNA wirusowego replikonu HCV ulegał selektywnemu i dramatycznemu zmniejszeniu, gdy miR-122 ulegał dezaktywacji (Fig. 2A, ścieżki 4 i 7). Zmniejszona ilość wirusowego mRNA prowadziła do zmniejszenia poziomu ekspresji białek HCV w komórkach transfekowanych oligomerem 122-2?OMe, podczas gdy w tych warunkach doświadczalnych poziom białka wskaźnikowego eGFP uległ zwiększeniu (Fig. 2B, ścieżka 3). Możliwe, że oligomery 122-2?OMe oddziałują na RNA 30 replikonu i poziomy białek poprzez oddziaływanie z negatywną nicią HCV, sekwencją która wykazuje miejsca oligomeru wiążące komplementarny z w znaczącą rejonie miR-122. komplementarność otaczającym Jednakże, negatywną nicią z przewidywane oligomer niekodującego w pełni rejonu 3? obejmującego przewidywane miejsce wiążące miR-122 w żaden sposób nie wirusowa wpływał negatywna na poziom nić nie replikonu, jest co dostępna sugeruje, dla że oligomeru. Ponadto, oligomer 122-2?OMe nie wpływał na poziom syntezy całkowitego białka w komórkach transfekowanych, co wyklucza możliwość, że oligomer 122-2?OMe indukował działania przeciwwirusowe. Podsumowując, odkrycia te wskazują, że miR122 jest krytyczny do utrzymywania wewnątrzkomórkowej dużej ilości cząsteczek RNA replikonu HCV. [0073] Aby stwierdzić czy miR-122 mógłby wpływać na akumulację RNA w komórkach świeżo tranfekowanych cząsteczkami RNA HCV ulegającymi zsyntetyzowano z cDNA replikacji, kodującego pełnej transkrypty długości RNA genom o genotypie 1 szczepu H77c z pięcioma adaptacyjnymi mutacjami (Fig. 2C, górny wykres), które umożliwiają uzyskanie wysokich poziomów replikacji RNA w komórkach Huh7 (Yi i Lemon, J. Virol. 78, 7904 (2004)). Wprowadzenie tych cząsteczek RNA do komórek obecności Huh7 prowadziło endogennego do miR-122 akumulacji (Fig. 2C, wirusowego ścieżki 1 RNA i w 2); przeciwnie, wirusowy RNA nie mógł być akumulowany, gdy miR122 był sekwestrowany przez oligomery 122-2?OMe (Fig. 2C, ścieżka 3). Zatem konieczna jest obecność miR-122 aby utrzymać dużą ilość RNA HCV w przypadku obu typów genotypów 1a i 1b, w liniach komórkowych, w których stabilnie zachodzi ekspresja i po bezpośredniej transfekcji. 31 [0074] Aby stwierdzić czy przypuszczalne miejsca wiążące miR122 były konieczne do wpływu miR-122 na akumulację RNA, mutacje wprowadzono do pełnej długości cDNA H77c. Transfekcja cząsteczkami RNA H77c zawierającymi mutację obejmującą podstawienie czterech nukleotydów w przewidywanym dopasowania regionie dopasowania do seed w niekodującym rejonie 3? (Fig. 3A), która powinna znosić wiązanie miR-122, nie zmniejszyła akumulacji RNA polegająca (Fig. na przewidywanym niekodującym 3B, substytucji regionie 5? ścieżka (Fig. 2). czterech dopasowania 3A) Przeciwnie, nie mutacja nukleotydów do seed prowadziła w do w rejonie indukowania akumulacji RNA (Fig. 3B, ścieżka 3). Co zdumiewające, genomy, w których obecne były mutacje polegające na substytucji dwóch nukleotydów (Fig. 3B, ścieżka 4) lub nawet jednego nukleotydu (Fig. 3B, ścieżka 5) w pozycji 27 w wirusowym genomie (m5?C) również nie powadziły do akumulacji po pięciu dniach od transfekcji. Uzyskane dane wskazują, że albo niezdolność do pozyskania miR-122 prowadziła do utraty wirusowego RNA, albo mutacje miały pewien wpływ na replikację lub stabilność RNA. [0075] Jeśli mutacje w sekwencji seed miR-122 zmniejszały akumulację RNA ze względu na słabe wiązanie miR-122, ekspresja ektopowa cząsteczek RNA miR-122, które zawierały mutację w trzecim nukleotydzie od końca 5? (mC) powinna przywracać tworzenie kompleksów RNA miR-122(mC)-m5?C (Lewis, i wsp., Cell 120, 15 (2005)). Ekspresja ektopowa cząsteczek RNA miR-122 zmutowanych typu dzikiego wirusowych nie cząsteczek prowadziła RNA do odzyskania zawierających m5?C (Fig. 3C, ścieżka 3), lecz zwiększała ilość cząsteczek RNA typu dzikiego (Fig. 3C, ścieżka 1) i cząsteczek RNA replikonu (Fig. S3A i B), co wskazuje, że wprowadzone cząsteczki RNA 32 miR-122 ulegały obróbce do funkcjonalnych jednoniciowych cząsteczek miR-122 RNA i że endogenna pula miR-122, która pośredniczy w akumulacji wirusowego RNA stanowi ograniczenie. Przeciwnie, ekspresja zmutowanych form dwuniciowych (dupleksów) m5?C miR-122 umożliwiała akumulację wirusowych RNA zawierających m5?C (Fig. 3C, ścieżka 4), silnie wskazując na genetyczne końcową 5? funkcjonowania oddziaływanie pomiędzy w HCV. genomie przez zmutowane miR-122 a Ponadto, cząsteczki sekwencją odzyskiwanie RNA wirusowego zawierające m5?C przez zmutowane cząsteczki mC-miR-122 musi być spowodowane raczej przez bezpośrednie oddziaływanie RNAmiR-122 HCV, niż przez pośrednie działanie poprzez inny, prawdopodobnie komórkowy cel dla miR-122. [0076] Następnie translację RNA twórcy HCV, badali która jak czy miR-122 wiadomo zachodzi moduluje poprzez niezwykły mechanizm wewnętrznego wejścia do rybosomu (Ji, i wsp., Proc. Natl. Acad. Sci. U S A 101, 16990 (2004); Otto, Cell 119, 369 (2004); Pestova, i wsp., Genes Dev. 12, 67 (1998)). Bardziej szczegółowo, twórcy badali produkcję białka rdzeniowego ulegających HCV na replikacji bazie i wirusowych nie cząsteczek ulegających replikacji, RNA w obecności lub przy braku funkcjonalnego miejsca wiążącego miR-122. Fig. 4 wskazuje, że podobne ilości białka rdzeniowego ulegały akumulacji w komórkach transfekowanych cząsteczkami RNA typu dzikiego (ścieżka 1) lub zmutowanych RNA m5?C (ścieżka 2) po dwudziestu godzinach od transfekcji, w momencie, ilości gdy RNA. Aby zsyntetyzowany translację z powinna zbadać wystąpić bezpośrednio wprowadzonych cząsteczek replikacja wirusowego niewielkiej czy rdzeń został cząsteczek RNA, badano RNA nie ulegających 33 replikacji. Wyniki wykazały, że wprowadzone cząsteczki RNA typu dzikiego (Fig. 4, ścieżka 3) i zmutowane m5?C (ścieżka 4) ulegały translacji z podobną wydajnością, co wskazuje, że miR-122 reguluje ilość RNA HCV na etapie następnym po etapie translacji, najprawdopodobniej na etapie replikacji RNA. [0077] Odkrycie twórców wynalazku, że cząsteczka miR-122 jest wiązana do sekwencji genomu HCV na jego końcu 5? jest nowym odkryciem. Wyniki te wykazują, że miR122 jest cząsteczką docelową przy kontrolowaniu poziomów HCV, i dlatego stanowi cel przy leczeniu stanów chorobowych związanych z zakażeniem HCV. II. Materiały i metody A. Oligonukleotydy i konstrukty DNA [0078] Oligonukleotydy RNA i 2?-O-metylowane oligonukleotydy zostały zsyntetyzowane przez spółkę Dharmacon Inc. (Lafayette, CO). Sekwencje były następujące: 122-2?OMe, 5?AGACACAAACACCAUUGUCACACUCCACAGC (SEQ ID NO:15); Rand-2?OMe, 5?CACGUUAAAACCAUACGCACUACGAAACCCC (SEQ ID NO:16); let7-2?OMe, 5?CUAAAACUAUACAACCUACUACCUCAUCCCA (SEQ ID NO:17); 122-2?OMe23, 5?ACAAACACCAUUGUCACACUCCA (SEQ ID NO:18); HCVbs-2?OMe, 5?UGAACGGGGAGCUAAACACUCCA ((SEQ ID NO:19); miR-122wt, 5?UGGAGUGUGACAAUGGUGUUUGU ((SEQ ID NO:20); miR-122mC, 5?UGCAGUGUGACAAUGGUGUUUGU (SEQ ID NO:21); miR-122*, 5?AAACGCCAUUAUCACACUAAAUA ((SEQ ID NO:22). Formy dwuniciowe utworzono pomiędzy cząsteczkami typu dzikiego lub formami mC miR-122 a miR-122*. Plazmid miR-122 niosący insercję białko z wskaźnikowe użyciem eGFP-122 techniki skonstruowano PCR poprzez sekwencji 34 5?ACAAACACCAUUGUCACACUCCA (SEQ ID NO:23), która wykazuje pełną komplementarność z miR-122, w miejsce restrykcyjne Not I w regionie niekodującym 3? plazmidu pd2eGFP-N1 (Clontech). Aby skonstruować wektor kontrolny eGFP-124, wprowadzono sekwencję 5?TTAAGGCACGCGGTGAATGCCA (SEQ ID NO:24), która jest komplementarna z miR 124 występującym selektywnie w mózgu. Mutacje polegające na substytucji wprowadzono do rejonów niekodujących 3? i wektora replikonu H77c (Yi & Lemon, J Virol 78, 7904 (Aug, 2004)) stosując nakładającą się PCR i mutagenne startery, a następnie ligację produktów PCR z wektorem wyjściowym. B. Hodowla i transfekcja komórek [0079] Komórki linii komórkowych Huh7, HeLa i HepG2 hodowano w DMEM uzupełnionym 10% FBS i 1% aminokwasami niebędącymi aminokwasami niezbędnymi zawierające dicistronowy (Gibco). replikon Komórki linii NNeo/C-5B, jak Huh7 opisano wcześniej (Ikeda, i wsp., J Virol 76, 2997 (Mar, 2002)), hodowano w obecności 1 mg/ml G418. Genomowy RNA ulegający transkrypcji H77c in vitro wprowadzono do komórek Huh7 przez elektroporację jak opisano w Yi & Lemon, supra, i uzyskano RNA, który poddano badaniu 5 dni później. Aby obserwować syntezę białek z RNA H77c nie ulegającego replikacji, zastosowano Dmrie-C (Invitrogen) w celu dostarczenia RNA do komórek Huh7, badaniu 20 i uzyskano godzin później. lizaty białkowe, Zastosowano taką które poddano metodę, gdyż komórki poddane elektroporacji nie były w pełni adherentne przy tak wcześnie przeprowadzonych badaniach. Konstrukty DNA i oligonukleotydy lipofektaminę 2000 wprowadzano (Invitrogen), do komórek zgodnie z stosując instrukcją 35 producenta. 2?-O-metylowane oligonukleotydy i dwuniowe RNA miR-122 dostarczano 6-studzienkowych w stężeniach szalkach. 50nM do Transfekowane komórek komórki w przed zebraniem hodowano przez 48 godzin. C. Wyodrębnianie RNA i Northern blotting [0080] Całkowity odczynnik RNA Trizol ekstrahowano (Invitrogen), z komórek zgodnie z stosując instrukcją producenta. Aby wykryć ekspresję miRNA, 30 ?g całkowitego RNA rozdzielono na 15% poliakrylamidowych żelach zawierających 7M mocznik w 0,5x TBE, przeniesiono na membranę Hybond N+ (Amersham) i hybrydyzowano z 32P-znakowanym oligonukleotydem 5? komplementarnym z 5?ACAAACACCAUUGUCACACUCCA miR-122 (SEQ ID o NO:25). sekwencji Aby zanalizować poziomy mRNA, 2,5 ?g RNA z komórek replikonu NNeo/C-5B, lub 15 ?g RNA z komórek transfekowanych RNA H77c, rozdzielono w 1% żelu agarozowym zawierającym bufor 1 x MOPS i 2,2M formaldehyd, i przenoszono na membranę Zeta-probe (Bio-Rad). Membrany hybrydyzowano w ExpressHyb (Clontech) z sondami random-primed znakowanymi 32P DNA odpowiadającym nukleotydom 84-374 HCV, 40-814 eGFP, i 685-1171 ?-aktyny jak wskazano. D. Western blotting i znakowanie metaboliczne [0081] Próbki białek otrzymano przez zeskrobanie komórek do RIPA zawierającego pełny koktajl inhibitorów proteaz (Roche). 10 ?g białka rozdzielono techniką SDS-PAGE w żelu 12% i przeniesiono na membranę Immobilon-P (Millipore). Membrany następnie znakowano z użyciem przeciwciała 6G7 skierowanego przeciwko białku rdzenia HCV (otrzymanego dzięki uprzejmości Harry?ego Greenberga, z Uniwersytetu Stanforda), lub 36 przeciwciał skierowanych przeciwko eGFP (Roche) lub aktynie (Sigma). Do znakowania metabolicznego komórki inkubowano w pożywce bez metioniny przez 1 godzinę przed inkubacją z 35Smetioniną przez 1 godzinę i ekstrakcją białka. Białko, 25 ?g, wytrącono stosując kwas trichlorooctowy i ilość wbudowanej 35S-metioniny określano ilościowo przez wiązanie z filtrem. E. Dane dotyczące sekwencji [0082] Sekwencje rejonów niekodujących 5? i 3? różnych genotypów HCV otrzymano z bazy danych HCV, obecnej na stronie internetowej, którą wytworzono przez wpisanie "http://" przed i ".gov" po "hcv.lanl" a reprezentatywne przykłady każdego z genotypów przedstawiono w tabeli 1. Szczepy były następujące: H77c (genotyp 1 a), nr dostępu w banku genów: AF011751; HCVN (1 b), AF139594; JFH-1 (2a), AB047639; NZL11 (3a), D17763; HEMA51 (4a), D45193 i D45194; FR741 (5a), D50466 i D50467; TH271 (6f), D37848 i D37858. [0083] Jest oczywiste, z powyższych wyników i dyskusji, że przedmiotem wynalazku są nowe sposoby leczenia chorób związanych z HCV. W związku z tym, wynalazek stanowi istotny wkład do stanu techniki. [0084] Publikacje cytuje się ze względu na ich ujawnienie przed datą zgłoszenia, lecz nie powinno to być interpretowane jako przyznanie, że wynalazek nie jest uprawniony do antydatowania takiej publikacji poprzedzającej wynalazek. [0085] Jakkolwiek powyższy wynalazek został opisany szczegółowo, jako ilustracja i przykład, aby zapewnić jasność i zrozumienie wynalazku, to jest oczywiste dla fachowca w tej dziedzinie w świetle modyfikacje mogą być tego opisu, wprowadzane do że pewne wynalazku zmiany w i zakresie 37 ograniczonym zastrzeżeniami. 20930/PE/16 EP 1 747 023 B2 LISTA SEKWENCJI Sposoby i kompozycje do zmniejszania wirusowego w komórkach docelowych ludzki ludzki ludzki ludzki ludzki ludzki ludzki ilości genomu 39 ludzki ludzki ludzki ludzki ludzki ludzki ludzki 40 ludzki ludzki ludzki ludzki ludzki ludzki ludzki ludzki 41 ludzki ludzki ludzki 20930/PE/16 EP 1 747 023 B2 Zastrzeżenia patentowe 1. Środek gospodarza z hamujący miR122 cierpiącego zakażeniem HCV, do na który zastosowania stan to w chorobowy środek jest leczeniu związany antysensowym oligonukleotydem i środek ten wiąże się z miR122. 2. Środek gospodarza według zastrz. cierpiącego 1 na do zastosowania stan chorobowy w leczeniu związany z zakażeniem HCV, gdzie gospodarzem jest człowiek. 3. Zastosowanie środka hamującego miR122 określonego w zastrz. 1 albo 2 do wytwarzania leku do leczenia gospodarza cierpiącego na stan chorobowy związany z zakażeniem HCV. 4. Sposób modulowania in vitro ilości genomu wirusa zapalenia wątroby typu C w komórce docelowej, który to sposób obejmuje hamowanie aktywności miR122 w tej komórce przez wprowadzenie do komórki środka hamującego miR122 określonego w dowolnym z zastrzeżeń 1 do 2. Fig. 1 replikon Neon/C-5B traktowane Neon/C-5B Huh7 HepG2 HeLa wątroba ludzka wątroba mysia 20930/PE/16 EP 1 747 023 B2 20930/PE/11 EP 1 747 023 B1 44 Fig. 2 20930/PE/11 EP 1 747 023 B1 45 Fig. 3 20930/PE/11 EP 1 747 023 B1 46 Fig. 4 20930/PE/11 EP 1 747 023 B1 47 Fig. S3















































Grupy dyskusyjne